Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-641

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
CTA-292E10.9
hsa-miR-641
0.974

Gene Details
Chromosome: 22
Transcript: ENST00000623127
Biotype: antisense
Gene id: ENSG00000280111
Gene Name: CTA-292E10.9
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
14834-14849
0.013
2
7mer
12572-12594
0.010
2
7mer
24800-24819
0.008
1
8mer
1710-1726
0.007
3
6mer
24307-24326
0.004
4
7mer
19068-19090
0.003
1
8mer
18461-18482
0.003
Not Conserved
6mer
733-752
0.002
1
6mer
12746-12771
0.002
7
6mer
24558-24581
0.002
1
6mer
4048-4072
0.002
4
6mer
2196-2218
0.002
Not Conserved
6mer
16747-16767
0.002
4
6mer
18876-18887
0.002
2
6mer
7664-7688
0.002
1
6mer
6513-6530
0.002
3
6mer
9172-9190
0.001
5
6mer
18171-18191
0.001
3
6mer
22156-22180
0.001
1
CTD-2017D11.1
hsa-miR-641
0.974

Gene Details
Chromosome: 19
Transcript: ENST00000597683
Biotype: lincRNA
Gene id: ENSG00000268362
Gene Name: CTD-2017D11.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1821-1840
0.055
2
6mer
1501-1526
0.015
2
RP11-528N21.1
hsa-miR-641
0.973

Gene Details
Chromosome: 3
Transcript: ENST00000456335
Biotype: lincRNA
Gene id: ENSG00000226302
Gene Name: RP11-528N21.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Brain Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
6-27
0.070
2
XLOC_010584
hsa-miR-641
0.972

Gene Details
Chromosome: chr13
Transcript: TCONS_00021981
Biotype: transcript isomorph
Gene id: XLOC_010584
Gene Name: XLOC_010584
UCSC graphic: -
Expression:
  Cell Line Tissue Category
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
Fibroblasts Lung Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1690-1704
0.040
2
8mer
362-383
0.023
4
6mer
31-53
0.005
2
LINC00638
hsa-miR-641
0.971

Gene Details
Chromosome: 14
Transcript: ENST00000555578
Biotype: lincRNA
Gene id: ENSG00000258701
Gene Name: LINC00638
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
2057-2070
0.054
2
6mer
626-650
0.014
2
XLOC_008328
hsa-miR-641
0.969

Gene Details
Chromosome: chrY
Transcript: TCONS_00017652
Biotype: transcript isomorph
Gene id: XLOC_008328
Gene Name: XLOC_008328
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
- Heart Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
857-871
0.055
1
6mer
466-481
0.012
1
LA16c-306A4.1
hsa-miR-641
0.968

Gene Details
Chromosome: 16
Transcript: ENST00000569106
Biotype: antisense
Gene id: ENSG00000260022
Gene Name: LA16c-306A4.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
231-256
0.066
2
DHRS4-AS1
hsa-miR-641
0.968

Gene Details
Chromosome: 14
Transcript: ENST00000556379
Biotype: antisense
Gene id: ENSG00000215256
Gene Name: DHRS4-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
64-84
0.057
3
7mer
447-465
0.008
2
6mer
1533-1553
0.002
2
SLC8A1-AS1
hsa-miR-641
0.967

Gene Details
Chromosome: 2
Transcript: ENST00000599956
Biotype: antisense
Gene id: ENSG00000227028
Gene Name: SLC8A1-AS1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
145-171
0.066
6
LINC00960
hsa-miR-641
0.967

Gene Details
Chromosome: 3
Transcript: ENST00000463183
Biotype: lincRNA
Gene id: ENSG00000242516
Gene Name: LINC00960
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
1311-1331
0.037
2
8mer
1267-1284
0.029
1
LINC00960
hsa-miR-641
0.967

Gene Details
Chromosome: 3
Transcript: NR_040005.1
Biotype: lincRNA
Gene id: NR_040005.1 (gene)
Gene Name: LINC00960
UCSC graphic: -
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
1260-1280
0.037
2
8mer
1216-1233
0.029
1
XLOC_010419
hsa-miR-641
0.967

Gene Details
Chromosome: chr13
Transcript: TCONS_00021820
Biotype: transcript isomorph
Gene id: XLOC_010419
Gene Name: XLOC_010419
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Heart Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
68-87
0.066
1
SLC8A1-AS1
hsa-miR-641
0.967

Gene Details
Chromosome: 2
Transcript: ENST00000601679
Biotype: antisense
Gene id: ENSG00000227028
Gene Name: SLC8A1-AS1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
343-369
0.066
6
TSIX
hsa-miR-641
0.967

Gene Details
Chromosome: X
Transcript: ENST00000604411
Biotype: lincRNA
Gene id: ENSG00000270641
Gene Name: TSIX
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
36672-36689
0.013
2
7mer
11174-11200
0.006
Not Conserved
8mer
30862-30873
0.005
Not Conserved
7mer
18171-18182
0.005
2
7mer
9606-9626
0.005
2
7mer
30373-30382
0.005
4
8mer
22090-22110
0.004
3
7mer
13654-13677
0.003
Not Conserved
6mer
34853-34879
0.003
5
7mer
15037-15058
0.003
Not Conserved
7mer
10903-10929
0.003
1
7mer
15128-15148
0.002
Not Conserved
6mer
9196-9220
0.002
2
6mer
24283-24293
0.002
2
6mer
20219-20233
0.002
2
6mer
22912-22937
0.001
2
6mer
5747-5763
0.001
2
6mer
16462-16476
0.001
1
6mer
10974-10990
0.000
1
TRHDE-AS1
hsa-miR-641
0.966

Gene Details
Chromosome: 12
Transcript: NR_026836.1
Biotype: antisense
Gene id: NR_026836.1 (gene)
Gene Name: TRHDE-AS1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
IMR90 Lung Embryonic/Fetal/Stem/Progenitor


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
94-110
0.033
2
8mer
735-757
0.017
5
8mer
1655-1671
0.009
4
6mer
419-436
0.006
1
TRHDE-AS1
hsa-miR-641
0.965

Gene Details
Chromosome: 12
Transcript: ENST00000426250
Biotype: antisense
Gene id: ENSG00000236333
Gene Name: TRHDE-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
94-110
0.034
2
8mer
735-757
0.017
5
8mer
1655-1671
0.009
4
6mer
419-436
0.005
1
RP11-61L19.1
hsa-miR-641
0.965

Gene Details
Chromosome: 18
Transcript: ENST00000580891
Biotype: sense_intronic
Gene id: ENSG00000266805
Gene Name: RP11-61L19.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
2135-2160
0.022
3
7mer
460-487
0.012
2
7mer
3458-3473
0.010
Not Conserved
7mer
1882-1905
0.006
2
6mer
273-285
0.006
2
6mer
1023-1045
0.004
2
7mer
2235-2247
0.003
2
6mer
1436-1458
0.001
1
XLOC_008283
hsa-miR-641
0.965

Gene Details
Chromosome: chrY
Transcript: TCONS_00017573
Biotype: transcript isomorph
Gene id: XLOC_008283
Gene Name: XLOC_008283
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
588-605
0.065
1
TTTY12
hsa-miR-641
0.964

Gene Details
Chromosome: Y
Transcript: ENST00000413466
Biotype: lincRNA
Gene id: ENSG00000237048
Gene Name: TTTY12
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
588-605
0.065
1
RP4-760C5.3
hsa-miR-641
0.963

Gene Details
Chromosome: 20
Transcript: ENST00000448580
Biotype: lincRNA
Gene id: ENSG00000231081
Gene Name: RP4-760C5.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
- Brain Normal/Primary
HeLa Cervix Cancer/Malignant
- Heart Normal/Primary
- Kidney Normal/Primary
- Ovary Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
458-477
0.064
2
Funded by: