Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-641

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
RP11-175O19.4
hsa-miR-641
0.963

Gene Details
Chromosome: 10
Transcript: ENST00000421806
Biotype: antisense
Gene id: ENSG00000231025
Gene Name: RP11-175O19.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
2043-2060
0.018
4
7mer
3001-3024
0.018
7
7mer
828-843
0.012
7
6mer
2712-2735
0.006
6
6mer
2790-2807
0.005
8
7mer
2885-2912
0.005
5
NEAT1
hsa-miR-641
0.962

Gene Details
Chromosome: 11
Transcript: ENST00000501122
Biotype: lincRNA
Gene id: ENSG00000245532
Gene Name: NEAT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
17331-17356
0.012
3
8mer
2544-2557
0.006
1
7mer
15836-15859
0.005
2
7mer
10843-10859
0.004
2
7mer
16417-16440
0.004
2
7mer
14812-14829
0.004
3
7mer
10341-10367
0.003
2
7mer
9326-9345
0.003
2
7mer
8895-8914
0.003
2
6mer
15105-15114
0.002
2
6mer
20555-20576
0.002
3
6mer
13257-13282
0.002
1
7mer
2941-2967
0.002
2
6mer
3415-3429
0.002
2
6mer
18539-18563
0.002
2
6mer
13808-13834
0.002
2
6mer
9796-9812
0.001
1
6mer
17865-17879
0.001
Not Conserved
6mer
2852-2875
0.001
1
6mer
9221-9237
0.001
1
6mer
12801-12825
0.001
1
6mer
14821-14843
0.001
3
6mer
17351-17367
0.001
1
LINC00924
hsa-miR-641
0.962

Gene Details
Chromosome: 15
Transcript: ENST00000556053
Biotype: lincRNA
Gene id: ENSG00000259134
Gene Name: LINC00924
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
2166-2188
0.061
1
6mer
1187-1207
0.003
6
XLOC_009652
hsa-miR-641
0.962

Gene Details
Chromosome: chr12
Transcript: TCONS_00021053
Biotype: transcript isomorph
Gene id: XLOC_009652
Gene Name: XLOC_009652
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary
Fibroblasts Lung Normal/Primary
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
131-153
0.063
2
LLNLF-173C4.1
hsa-miR-641
0.961

Gene Details
Chromosome: 19
Transcript: ENST00000615123
Biotype: lincRNA
Gene id: ENSG00000278323
Gene Name: LLNLF-173C4.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
135-147
0.053
1
7mer
536-553
0.010
Not Conserved
RP11-15H20.6
hsa-miR-641
0.961

Gene Details
Chromosome: 19
Transcript: ENST00000601239
Biotype: retained_intron
Gene id: ENSG00000213971
Gene Name: RP11-15H20.6
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
635-656
0.063
2
XLOC_001719
hsa-miR-641
0.960

Gene Details
Chromosome: chr2
Transcript: TCONS_00003915
Biotype: transcript isomorph
Gene id: XLOC_001719
Gene Name: XLOC_001719
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1552-1570
0.039
2
7mer
782-797
0.015
3
6mer
188-204
0.004
2
6mer
1303-1314
0.004
2
RP11-216M21.7
hsa-miR-641
0.959

Gene Details
Chromosome: 9
Transcript: ENST00000450520
Biotype: lincRNA
Gene id: ENSG00000233207
Gene Name: RP11-216M21.7
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Brain Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1542-1561
0.026
1
7mer
2938-2960
0.026
1
6mer
1018-1041
0.010
1
RP11-616M22.7
hsa-miR-641
0.959

Gene Details
Chromosome: 16
Transcript: ENST00000561649
Biotype: lincRNA
Gene id: ENSG00000260710
Gene Name: RP11-616M22.7
UCSC graphic:
Expression:
  Cell Line Tissue Category
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
95-115
0.062
2
XLOC_004584
hsa-miR-641
0.959

Gene Details
Chromosome: chr5
Transcript: TCONS_00010118
Biotype: transcript isomorph
Gene id: XLOC_004584
Gene Name: XLOC_004584
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary
Fibroblasts Lung Normal/Primary
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
4486-4506
0.042
2
6mer
4723-4748
0.008
4
7mer
2961-2978
0.007
1
7mer
1132-1159
0.004
1
7mer
3354-3380
0.002
1
XLOC_013851
hsa-miR-641
0.958

Gene Details
Chromosome: chr21
Transcript: TCONS_00029192
Biotype: transcript isomorph
Gene id: XLOC_013851
Gene Name: XLOC_013851
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
- Brain Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Breast Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
- Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
- Ovary Normal/Primary
- Placenta Normal/Primary
- Testes Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
247-269
0.044
2
7mer
111-125
0.018
1
XLOC_005479
hsa-miR-641
0.958

Gene Details
Chromosome: chr6
Transcript: TCONS_00012608
Biotype: transcript isomorph
Gene id: XLOC_005479
Gene Name: XLOC_005479
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
- Kidney Normal/Primary
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
2293-2312
0.053
1
6mer
1998-2021
0.006
1
6mer
1836-1853
0.003
2
RP11-526P5.2
hsa-miR-641
0.958

Gene Details
Chromosome: 10
Transcript: ENST00000438753
Biotype: lincRNA
Gene id: ENSG00000235281
Gene Name: RP11-526P5.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
658-679
0.043
6
8mer
475-493
0.019
2
XLOC_013000
hsa-miR-641
0.957

Gene Details
Chromosome: chr19
Transcript: TCONS_00026939
Biotype: transcript isomorph
Gene id: XLOC_013000
Gene Name: XLOC_013000
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
181-193
0.036
1
7mer
189-213
0.025
1
SLC8A1-AS1
hsa-miR-641
0.957

Gene Details
Chromosome: 2
Transcript: ENST00000597385
Biotype: antisense
Gene id: ENSG00000227028
Gene Name: SLC8A1-AS1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
215-241
0.061
6
MIR4534
hsa-miR-641
0.955

Gene Details
Chromosome: 22
Transcript: ENST00000623111
Biotype: sense_overlapping
Gene id: ENSG00000279010
Gene Name: MIR4534
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
15098-15110
0.009
2
6mer
54365-54384
0.005
Not Conserved
7mer
37710-37735
0.004
7
6mer
25800-25808
0.003
9
6mer
19671-19688
0.002
5
7mer
1770-1791
0.002
1
7mer
2985-3006
0.002
1
6mer
15375-15401
0.002
4
6mer
24183-24202
0.002
6
6mer
25455-25475
0.002
6
6mer
29265-29282
0.002
2
6mer
16560-16574
0.002
2
6mer
9668-9680
0.001
2
6mer
31477-31499
0.001
1
6mer
26503-26512
0.001
1
6mer
45748-45767
0.001
2
6mer
39320-39335
0.001
3
6mer
50687-50706
0.001
3
7mer
44614-44636
0.001
3
6mer
26211-26221
0.001
1
6mer
26317-26325
0.001
2
6mer
28888-28907
0.001
2
6mer
23098-23122
0.001
Not Conserved
6mer
9157-9180
0.001
Not Conserved
6mer
47198-47224
0.001
2
6mer
34048-34064
0.001
1
6mer
10953-10968
0.001
Not Conserved
6mer
4623-4637
0.001
1
6mer
11130-11150
0.001
2
6mer
36957-36970
0.001
2
6mer
20846-20866
0.001
1
6mer
28951-28968
0.001
1
6mer
10961-10984
0.001
4
XLOC_013263
hsa-miR-641
0.954

Gene Details
Chromosome: chr19
Transcript: TCONS_00027223
Biotype: transcript isomorph
Gene id: XLOC_013263
Gene Name: XLOC_013263
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
- Heart Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
- Kidney Normal/Primary
- Liver Normal/Primary
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
75-97
0.028
1
8mer
429-450
0.019
1
7mer
316-329
0.013
1
CTD-2017D11.1
hsa-miR-641
0.952

Gene Details
Chromosome: 19
Transcript: ENST00000594934
Biotype: lincRNA
Gene id: ENSG00000268362
Gene Name: CTD-2017D11.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1498-1517
0.047
2
6mer
1178-1203
0.013
2
LINC01194
hsa-miR-641
0.952

Gene Details
Chromosome: 5
Transcript: ENST00000505877
Biotype: lincRNA
Gene id: ENSG00000248131
Gene Name: LINC01194
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
787-805
0.023
1
7mer
977-994
0.016
2
6mer
1203-1217
0.010
2
7mer
632-656
0.010
2
RP11-856M7.6
hsa-miR-641
0.952

Gene Details
Chromosome: 18
Transcript: ENST00000583691
Biotype: lincRNA
Gene id: ENSG00000266604
Gene Name: RP11-856M7.6
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
425-443
0.030
1
7mer
514-535
0.029
1
Funded by: