Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-641

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
AC005592.3
hsa-miR-641
0.951

Gene Details
Chromosome: 5
Transcript: ENST00000566527
Biotype: lincRNA
Gene id: ENSG00000261757
Gene Name: AC005592.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
735-757
0.024
3
7mer
1401-1427
0.013
2
7mer
1038-1059
0.009
2
7mer
935-958
0.006
1
6mer
1207-1227
0.005
1
6mer
950-974
0.003
1
RP4-668E10.4
hsa-miR-641
0.951

Gene Details
Chromosome: 7
Transcript: ENST00000614289
Biotype: lincRNA
Gene id: ENSG00000278254
Gene Name: RP4-668E10.4
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1664-1687
0.042
2
7mer
500-513
0.013
2
6mer
1609-1622
0.004
2
ERVH48-1
hsa-miR-641
0.951

Gene Details
Chromosome: 21
Transcript: ENST00000617971
Biotype: lincRNA
Gene id: ENSG00000233056
Gene Name: ERVH48-1
UCSC graphic:
Expression:
  Cell Line Tissue Category
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
283-297
0.027
1
6mer
2048-2068
0.018
1
6mer
1607-1632
0.014
1
TTTY10
hsa-miR-641
0.950

Gene Details
Chromosome: Y
Transcript: ENST00000455084
Biotype: lincRNA
Gene id: ENSG00000229236
Gene Name: TTTY10
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
1217-1233
0.059
1
RP11-194G10.3
hsa-miR-641
0.950

Gene Details
Chromosome: 3
Transcript: ENST00000596963
Biotype: lincRNA
Gene id: ENSG00000269391
Gene Name: RP11-194G10.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
400-418
0.059
2
LINC01189
hsa-miR-641
0.950

Gene Details
Chromosome: 9
Transcript: ENST00000428440
Biotype: lincRNA
Gene id: ENSG00000232827
Gene Name: LINC01189
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
225-247
0.020
2
7mer
33-54
0.015
1
6mer
652-670
0.014
2
7mer
1437-1457
0.010
2
RP11-403I13.5
hsa-miR-641
0.949

Gene Details
Chromosome: 1
Transcript: ENST00000443018
Biotype: lincRNA
Gene id: ENSG00000232721
Gene Name: RP11-403I13.5
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
510-530
0.037
1
7mer
1231-1256
0.009
2
6mer
2626-2647
0.006
2
6mer
2460-2476
0.003
1
6mer
1677-1699
0.002
2
7mer
1267-1282
0.002
1
LINC00535
hsa-miR-641
0.948

Gene Details
Chromosome: 8
Transcript: ENST00000501400
Biotype: antisense
Gene id: ENSG00000246662
Gene Name: LINC00535
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
310-335
0.036
8
6mer
24-41
0.013
5
6mer
141-166
0.006
5
6mer
205-228
0.004
1
RP11-508N22.12
hsa-miR-641
0.946

Gene Details
Chromosome: 10
Transcript: ENST00000608335
Biotype: lincRNA
Gene id: ENSG00000272983
Gene Name: RP11-508N22.12
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
6716-6743
0.020
2
7mer
23-46
0.011
2
6mer
241-262
0.010
2
6mer
538-556
0.008
2
6mer
1337-1358
0.003
1
6mer
1756-1772
0.003
2
6mer
4794-4818
0.003
1
XLOC_012006
hsa-miR-641
0.946

Gene Details
Chromosome: chr16
Transcript: TCONS_00024726
Biotype: transcript isomorph
Gene id: XLOC_012006
Gene Name: XLOC_012006
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
668-684
0.033
5
8mer
314-322
0.024
1
LL22NC03-2H8.5
hsa-miR-641
0.945

Gene Details
Chromosome: 22
Transcript: ENST00000610778
Biotype: lincRNA
Gene id: ENSG00000274422
Gene Name: LL22NC03-2H8.5
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
644-658
0.036
2
8mer
180-199
0.022
1
PAPPA-AS1
hsa-miR-641
0.945

Gene Details
Chromosome: 9
Transcript: ENST00000445861
Biotype: antisense
Gene id: ENSG00000256040
Gene Name: PAPPA-AS1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
2148-2173
0.023
3
6mer
2414-2436
0.010
8
7mer
420-439
0.009
3
6mer
2013-2030
0.008
7
6mer
212-235
0.007
6
TEX41
hsa-miR-641
0.945

Gene Details
Chromosome: 2
Transcript: ENST00000599187
Biotype: lincRNA
Gene id: ENSG00000226674
Gene Name: TEX41
UCSC graphic:
Expression:
  Cell Line Tissue Category
hMSC-BM Bone Marrow Stem/Progenitor
A549 Lung Cancer/Malignant


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
830-852
0.030
2
9mer
128-146
0.027
2
SLC8A1-AS1
hsa-miR-641
0.944

Gene Details
Chromosome: 2
Transcript: ENST00000596532
Biotype: antisense
Gene id: ENSG00000227028
Gene Name: SLC8A1-AS1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
242-268
0.057
6
XLOC_002806
hsa-miR-641
0.943

Gene Details
Chromosome: chr3
Transcript: TCONS_00006965
Biotype: transcript isomorph
Gene id: XLOC_002806
Gene Name: XLOC_002806
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
275-286
0.032
2
7mer
301-313
0.024
2
RP11-546O6.4
hsa-miR-641
0.943

Gene Details
Chromosome: 9
Transcript: ENST00000562653
Biotype: lincRNA
Gene id: ENSG00000260677
Gene Name: RP11-546O6.4
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1545-1568
0.047
5
7mer
348-369
0.009
Not Conserved
XLOC_009783
hsa-miR-641
0.941

Gene Details
Chromosome: chr12
Transcript: TCONS_00020451
Biotype: transcript isomorph
Gene id: XLOC_009783
Gene Name: XLOC_009783
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
- Brain Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
150-165
0.029
1
6mer
520-542
0.014
1
6mer
1307-1333
0.013
1
XLOC_002318
hsa-miR-641
0.940

Gene Details
Chromosome: chr2
Transcript: TCONS_00004444
Biotype: transcript isomorph
Gene id: XLOC_002318
Gene Name: XLOC_002318
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
30-55
0.056
1
FAM201A
hsa-miR-641
0.938

Gene Details
Chromosome: 9
Transcript: ENST00000377680
Biotype: antisense
Gene id: ENSG00000204860
Gene Name: FAM201A
UCSC graphic:
Expression:
  Cell Line Tissue Category
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
3200-3223
0.035
1
6mer
2759-2775
0.007
1
7mer
2267-2290
0.007
1
7mer
1378-1402
0.006
1
RP5-1185K9.1
hsa-miR-641
0.938

Gene Details
Chromosome: 20
Transcript: ENST00000438222
Biotype: lincRNA
Gene id: ENSG00000238034
Gene Name: RP5-1185K9.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
78-99
0.048
2
6mer
386-408
0.007
3
Funded by: