Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-641

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
TEX41
hsa-miR-641
0.937

Gene Details
Chromosome: 2
Transcript: ENST00000596230
Biotype: lincRNA
Gene id: ENSG00000226674
Gene Name: TEX41
UCSC graphic:
Expression:
  Cell Line Tissue Category
hMSC-BM Bone Marrow Stem/Progenitor
A549 Lung Cancer/Malignant


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
163-181
0.028
2
8mer
630-652
0.024
2
6mer
577-586
0.003
2
XLOC_000190
hsa-miR-641
0.937

Gene Details
Chromosome: chr1
Transcript: TCONS_00000937
Biotype: transcript isomorph
Gene id: XLOC_000190
Gene Name: XLOC_000190
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary
Fibroblasts Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
4428-4446
0.039
1
7mer
988-1005
0.008
2
6mer
291-305
0.003
Not Conserved
6mer
4075-4094
0.003
1
6mer
2681-2695
0.001
2
6mer
1078-1105
0.001
1
RP11-342K6.1
hsa-miR-641
0.936

Gene Details
Chromosome: 2
Transcript: ENST00000604845
Biotype: antisense
Gene id: ENSG00000270696
Gene Name: RP11-342K6.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1396-1418
0.043
2
6mer
312-333
0.004
1
6mer
223-244
0.004
1
6mer
221-235
0.003
1
XLOC_012370
hsa-miR-641
0.935

Gene Details
Chromosome: chr17
Transcript: TCONS_00025543
Biotype: transcript isomorph
Gene id: XLOC_012370
Gene Name: XLOC_012370
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
- Brain Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
- Heart Normal/Primary
- Kidney Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
- Liver Normal/Primary
HepG2 Liver Cancer/Malignant
- Lung Normal/Primary
A549 Lung Cancer/Malignant
- Lymph Node Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
1760-1780
0.034
1
7mer
530-556
0.020
1
RP11-856M7.6
hsa-miR-641
0.933

Gene Details
Chromosome: 18
Transcript: ENST00000584734
Biotype: lincRNA
Gene id: ENSG00000266604
Gene Name: RP11-856M7.6
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
614-635
0.027
1
7mer
523-541
0.027
1
RP11-466F5.10
hsa-miR-641
0.932

Gene Details
Chromosome: 1
Transcript: ENST00000608512
Biotype: lincRNA
Gene id: ENSG00000273365
Gene Name: RP11-466F5.10
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
179-192
0.033
2
7mer
423-444
0.012
1
6mer
394-413
0.008
2
TEX41
hsa-miR-641
0.932

Gene Details
Chromosome: 2
Transcript: ENST00000600679
Biotype: lincRNA
Gene id: ENSG00000226674
Gene Name: TEX41
UCSC graphic:
Expression:
  Cell Line Tissue Category
hMSC-BM Bone Marrow Stem/Progenitor
A549 Lung Cancer/Malignant


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
170-188
0.027
2
8mer
713-735
0.027
2
RP11-267N12.1
hsa-miR-641
0.931

Gene Details
Chromosome: 1
Transcript: ENST00000415437
Biotype: antisense
Gene id: ENSG00000232892
Gene Name: RP11-267N12.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
2516-2538
0.019
2
8mer
1708-1731
0.011
Not Conserved
7mer
1617-1640
0.010
5
7mer
1887-1909
0.006
4
6mer
2023-2038
0.004
1
6mer
522-539
0.003
3
XLOC_009279
hsa-miR-641
0.931

Gene Details
Chromosome: chr11
Transcript: TCONS_00019476
Biotype: transcript isomorph
Gene id: XLOC_009279
Gene Name: XLOC_009279
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
Fibroblasts Lung Normal/Primary
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
2812-2836
0.027
2
7mer
2863-2887
0.018
1
7mer
2057-2083
0.004
1
7mer
1551-1564
0.003
2
8mer+mismatch
1018-1034
0.002
1
RP11-380B4.3
hsa-miR-641
0.931

Gene Details
Chromosome: 13
Transcript: ENST00000617901
Biotype: lincRNA
Gene id: ENSG00000277151
Gene Name: RP11-380B4.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
5102-5122
0.018
1
7mer
1482-1500
0.007
2
7mer
717-725
0.005
3
7mer
1864-1885
0.005
1
7mer
2551-2570
0.005
Not Conserved
6mer
545-566
0.005
1
6mer
791-817
0.004
3
6mer
3057-3076
0.003
4
6mer
3284-3292
0.002
2
XLOC_003657
hsa-miR-641
0.931

Gene Details
Chromosome: chr4
Transcript: TCONS_00008203
Biotype: transcript isomorph
Gene id: XLOC_003657
Gene Name: XLOC_003657
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Heart Normal/Primary
- Lung Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
367-388
0.021
2
7mer
803-823
0.012
Not Conserved
7mer
161-184
0.010
1
6mer
203-221
0.005
2
6mer
1048-1069
0.005
2
RP11-363G2.4
hsa-miR-641
0.928

Gene Details
Chromosome: 13
Transcript: ENST00000445646
Biotype: lincRNA
Gene id: ENSG00000229556
Gene Name: RP11-363G2.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
1969-1989
0.030
1
7mer
1388-1412
0.023
1
XLOC_007236
hsa-miR-641
0.928

Gene Details
Chromosome: chr8
Transcript: TCONS_00015182
Biotype: transcript isomorph
Gene id: XLOC_007236
Gene Name: XLOC_007236
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
7-27
0.046
2
6mer
94-113
0.007
1
RP11-679B19.1
hsa-miR-641
0.927

Gene Details
Chromosome: 16
Transcript: ENST00000622621
Biotype: antisense
Gene id: ENSG00000277954
Gene Name: RP11-679B19.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
314-324
0.036
8
8mer
3663-3687
0.010
1
7mer
1626-1645
0.006
4
XLOC_001333
hsa-miR-641
0.926

Gene Details
Chromosome: chr2
Transcript: TCONS_00004690
Biotype: transcript isomorph
Gene id: XLOC_001333
Gene Name: XLOC_001333
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
323-350
0.046
1
7mer
1795-1813
0.004
1
6mer
2127-2144
0.002
2
PCAT14
hsa-miR-641
0.924

Gene Details
Chromosome: 22
Transcript: NR_109832.1
Biotype: lincRNA
Gene id: NR_109832.1 (gene)
Gene Name: PCAT14
UCSC graphic: -
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
138-159
0.031
1
6mer
901-926
0.020
1
TTLL7-IT1
hsa-miR-641
0.923

Gene Details
Chromosome: 1
Transcript: ENST00000455929
Biotype: sense_intronic
Gene id: ENSG00000233061
Gene Name: TTLL7-IT1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
2729-2750
0.016
1
8mer
1453-1470
0.013
2
7mer
470-493
0.011
1
6mer
797-822
0.006
4
6mer
45-59
0.006
2
RP11-232M24.1
hsa-miR-641
0.923

Gene Details
Chromosome: 3
Transcript: ENST00000471638
Biotype: lincRNA
Gene id: ENSG00000242671
Gene Name: RP11-232M24.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
858-877
0.022
4
7mer
1365-1389
0.018
4
6mer
1693-1718
0.011
9
XLOC_009561
hsa-miR-641
0.923

Gene Details
Chromosome: chr11
Transcript: TCONS_00019766
Biotype: transcript isomorph
Gene id: XLOC_009561
Gene Name: XLOC_009561
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Colon Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
- Testes Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
25-48
0.051
Not Conserved
FMR1-AS1
hsa-miR-641
0.922

Gene Details
Chromosome: X
Transcript: ENST00000598667
Biotype: antisense
Gene id: ENSG00000268066
Gene Name: FMR1-AS1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
295-318
0.026
4
8mer
90-106
0.022
2
6mer
1074-1100
0.003
3
Funded by: