Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-641

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
RP11-438B23.2
hsa-miR-641
0.921

Gene Details
Chromosome: 9
Transcript: ENST00000566293
Biotype: sense_overlapping
Gene id: ENSG00000260412
Gene Name: RP11-438B23.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
66-88
0.019
11
8mer
5071-5098
0.014
2
6mer
6316-6331
0.007
4
7mer
6546-6562
0.006
1
6mer
163-179
0.006
6
CTD-2050N2.1
hsa-miR-641
0.921

Gene Details
Chromosome: 15
Transcript: ENST00000559799
Biotype: antisense
Gene id: ENSG00000259221
Gene Name: CTD-2050N2.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HeLa Cervix Cancer/Malignant


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
140-162
0.051
2
CTBP1-AS2
hsa-miR-641
0.921

Gene Details
Chromosome: 4
Transcript: ENST00000505364
Biotype: antisense
Gene id: ENSG00000196810
Gene Name: CTBP1-AS2
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
252-271
0.031
2
7mer
694-714
0.020
2
AC002310.12
hsa-miR-641
0.920

Gene Details
Chromosome: 16
Transcript: ENST00000457283
Biotype: antisense
Gene id: ENSG00000235560
Gene Name: AC002310.12
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
1035-1054
0.014
2
9mer
736-758
0.014
Not Conserved
7mer
76-96
0.011
1
7mer
1342-1363
0.010
2
6mer
758-783
0.002
2
OIP5-AS1
hsa-miR-641
0.920

Gene Details
Chromosome: 15
Transcript: ENST00000500949
Biotype: antisense
Gene id: ENSG00000247556
Gene Name: OIP5-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
HREpiC Kidney Normal/Primary
- Liver Normal/Primary
HepG2 Liver Cancer/Malignant
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
- Lymph Node Normal/Primary
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
2882-2890
0.014
13
7mer
701-727
0.009
4
7mer
3513-3532
0.006
2
7mer
3587-3604
0.003
5
6mer
550-564
0.003
1
6mer
5487-5513
0.003
6
6mer
8145-8170
0.003
1
8mer
3524-3548
0.003
2
7mer
1784-1803
0.002
1
6mer
7086-7103
0.002
2
7mer
3184-3207
0.002
2
6mer
1821-1848
0.001
4
LOC100128885
hsa-miR-641
0.919

Gene Details
Chromosome: 7
Transcript: NR_077227.1
Biotype: lincRNA
Gene id: NR_077227.1 (gene)
Gene Name: LOC100128885
UCSC graphic: -
Expression: -


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer+wobble
29-55
0.018
1
7mer
2529-2552
0.011
1
7mer
3768-3781
0.010
1
6mer
10-35
0.009
1
6mer
1796-1808
0.002
1
XLOC_006810
hsa-miR-641
0.919

Gene Details
Chromosome: chr8
Transcript: TCONS_00014719
Biotype: transcript isomorph
Gene id: XLOC_006810
Gene Name: XLOC_006810
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
- Kidney Normal/Primary
- Lymph Node Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
56-82
0.024
3
7mer
554-564
0.021
2
6mer
406-432
0.006
2
CTA-796E4.5
hsa-miR-641
0.918

Gene Details
Chromosome: 22
Transcript: ENST00000624243
Biotype: lincRNA
Gene id: ENSG00000280065
Gene Name: CTA-796E4.5
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
21176-21192
0.006
6
7mer
18770-18785
0.005
2
7mer
1277-1299
0.004
2
7mer
15850-15867
0.004
1
6mer
31130-31139
0.004
2
7mer
10497-10523
0.003
4
6mer
530-555
0.002
2
6mer
30697-30717
0.002
Not Conserved
6mer
7974-7992
0.002
4
6mer
11120-11143
0.002
2
7mer
22889-22911
0.002
3
6mer
15429-15448
0.002
4
6mer
16745-16766
0.002
1
6mer
24472-24494
0.001
1
6mer
27685-27707
0.001
2
6mer
8236-8255
0.001
1
6mer
29075-29095
0.001
2
6mer
3453-3465
0.001
2
6mer
8680-8704
0.001
2
6mer
2616-2629
0.001
1
6mer
12133-12149
0.001
Not Conserved
6mer
29151-29174
0.001
2
MIR6818
hsa-miR-641
0.917

Gene Details
Chromosome: 22
Transcript: ENST00000624945
Biotype: antisense
Gene id: ENSG00000279159
Gene Name: MIR6818
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
28449-28472
0.011
2
8mer
31324-31342
0.006
1
7mer
5739-5753
0.005
4
6mer
9595-9607
0.005
14
7mer
37844-37859
0.004
1
6mer
17740-17744
0.003
5
7mer
27972-27983
0.003
2
7mer
5941-5967
0.002
1
6mer
22009-22035
0.002
2
6mer
30890-30898
0.002
4
6mer
26183-26199
0.002
1
6mer
1249-1266
0.002
1
6mer
32248-32257
0.001
1
6mer
17642-17667
0.001
4
6mer
40899-40919
0.001
1
6mer
32122-32135
0.001
1
FMR1-AS1
hsa-miR-641
0.917

Gene Details
Chromosome: X
Transcript: ENST00000594922
Biotype: antisense
Gene id: ENSG00000268066
Gene Name: FMR1-AS1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
295-318
0.024
4
8mer
90-106
0.023
2
6mer
1074-1100
0.002
3
LL22NC03-22D1.1
hsa-miR-641
0.916

Gene Details
Chromosome: 22
Transcript: ENST00000624601
Biotype: lincRNA
Gene id: ENSG00000279003
Gene Name: LL22NC03-22D1.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
5122-5144
0.009
5
6mer
289-312
0.005
3
7mer
19502-19523
0.005
2
7mer
12028-12053
0.005
Not Conserved
7mer
3016-3035
0.003
1
7mer
2020-2042
0.003
1
6mer
8555-8577
0.003
2
6mer
6843-6862
0.002
1
6mer
17859-17863
0.002
2
6mer
26021-26039
0.002
2
6mer
7372-7395
0.002
2
6mer
24253-24274
0.002
2
6mer
17337-17359
0.002
5
7mer
7036-7055
0.002
1
6mer
5289-5316
0.002
Not Conserved
6mer
19103-19123
0.001
1
XLOC_007528
hsa-miR-641
0.916

Gene Details
Chromosome: chr9
Transcript: TCONS_00016134
Biotype: transcript isomorph
Gene id: XLOC_007528
Gene Name: XLOC_007528
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
- Brain Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
- Kidney Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary
LCLBACD2 - Normal/Primary


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
553-574
0.024
1
7mer
864-880
0.009
2
8mer
269-287
0.008
Not Conserved
6mer
1173-1194
0.003
3
6mer
5298-5318
0.003
1
6mer
1656-1677
0.002
4
6mer
2168-2186
0.002
1
6mer
2181-2201
0.000
1
AC004069.2
hsa-miR-641
0.914

Gene Details
Chromosome: 4
Transcript: ENST00000504082
Biotype: lincRNA
Gene id: ENSG00000251259
Gene Name: AC004069.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary
Fibroblasts Lung Normal/Primary
- Lung Normal/Primary
- Lymph Node Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
6-26
0.049
3
LINC00470
hsa-miR-641
0.914

Gene Details
Chromosome: 18
Transcript: ENST00000584492
Biotype: lincRNA
Gene id: ENSG00000132204
Gene Name: LINC00470
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
A549 Lung Cancer/Malignant
LCLBACD2 - Normal/Primary


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1114-1135
0.033
1
7mer
385-401
0.016
3
FMR1-AS1
hsa-miR-641
0.914

Gene Details
Chromosome: X
Transcript: ENST00000601841
Biotype: retained_intron
Gene id: ENSG00000268066
Gene Name: FMR1-AS1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
295-318
0.024
4
8mer
90-106
0.023
2
6mer
1074-1100
0.002
3
CTD-2313F11.1
hsa-miR-641
0.913

Gene Details
Chromosome: 5
Transcript: ENST00000608975
Biotype: retained_intron
Gene id: ENSG00000240535
Gene Name: CTD-2313F11.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
HUVEC Blood Vessel Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
468-489
0.049
2
FMR1-AS1
hsa-miR-641
0.913

Gene Details
Chromosome: X
Transcript: ENST00000596112
Biotype: antisense
Gene id: ENSG00000268066
Gene Name: FMR1-AS1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
295-318
0.023
4
8mer
90-106
0.023
2
6mer
1074-1100
0.003
3
TEX41
hsa-miR-641
0.913

Gene Details
Chromosome: 2
Transcript: ENST00000597670
Biotype: lincRNA
Gene id: ENSG00000226674
Gene Name: TEX41
UCSC graphic:
Expression:
  Cell Line Tissue Category
hMSC-BM Bone Marrow Stem/Progenitor
A549 Lung Cancer/Malignant


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
208-226
0.029
2
8mer
613-635
0.020
2
XLOC_002953
hsa-miR-641
0.913

Gene Details
Chromosome: chr3
Transcript: TCONS_00006338
Biotype: transcript isomorph
Gene id: XLOC_002953
Gene Name: XLOC_002953
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
556-576
0.045
8
7mer
273-292
0.004
1
RP11-529E10.6
hsa-miR-641
0.912

Gene Details
Chromosome: 4
Transcript: ENST00000564650
Biotype: sense_overlapping
Gene id: ENSG00000261643
Gene Name: RP11-529E10.6
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
8-28
0.049
1
Funded by: