Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-641

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
LINC00312
hsa-miR-641
0.910

Gene Details
Chromosome: 3
Transcript: ENST00000442796
Biotype: lincRNA
Gene id: ENSG00000237697
Gene Name: LINC00312
UCSC graphic:
Expression:
  Cell Line Tissue Category
A549 Lung Cancer/Malignant


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
221-248
0.043
3
6mer
1599-1625
0.005
2
LOC100190986
hsa-miR-641
0.909

Gene Details
Chromosome: 16
Transcript: NR_024456.1
Biotype: sense
Gene id: NR_024456.1 (gene)
Gene Name: LOC100190986
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1837-1856
0.048
1
XLOC_009990
hsa-miR-641
0.908

Gene Details
Chromosome: chr12
Transcript: TCONS_00020685
Biotype: transcript isomorph
Gene id: XLOC_009990
Gene Name: XLOC_009990
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
- Brain Normal/Primary
- Colon Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
Fibroblasts Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
105-127
0.018
2
6mer
21-26
0.014
2
6mer
1441-1467
0.009
2
7mer
320-342
0.008
1
TTN-AS1
hsa-miR-641
0.908

Gene Details
Chromosome: 2
Transcript: ENST00000585451
Biotype: antisense
Gene id: ENSG00000237298
Gene Name: TTN-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
829-850
0.021
1
7mer
504-525
0.012
9
7mer
818-840
0.011
2
6mer
57-72
0.004
2
PKN2-AS1
hsa-miR-641
0.906

Gene Details
Chromosome: 1
Transcript: ENST00000458097
Biotype: antisense
Gene id: ENSG00000237505
Gene Name: PKN2-AS1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
531-557
0.024
5
7mer
518-535
0.012
8
7mer
374-400
0.011
8
LINC01422
hsa-miR-641
0.906

Gene Details
Chromosome: 22
Transcript: ENST00000434868
Biotype: lincRNA
Gene id: ENSG00000223704
Gene Name: LINC01422
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
5795-5808
0.036
1
7mer
623-637
0.005
1
7mer
5403-5424
0.005
2
6mer
4875-4896
0.002
2
RP11-137H15.3
hsa-miR-641
0.905

Gene Details
Chromosome: 14
Transcript: ENST00000619996
Biotype: lincRNA
Gene id: ENSG00000274546
Gene Name: RP11-137H15.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
352-375
0.030
3
7mer
101-106
0.018
4
XLOC_005476
hsa-miR-641
0.905

Gene Details
Chromosome: chr6
Transcript: TCONS_00011964
Biotype: transcript isomorph
Gene id: XLOC_005476
Gene Name: XLOC_005476
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
1900-1922
0.048
4
RP11-556I13.2
hsa-miR-641
0.905

Gene Details
Chromosome: 7
Transcript: ENST00000595842
Biotype: antisense
Gene id: ENSG00000268170
Gene Name: RP11-556I13.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
1643-1669
0.037
2
6mer
327-350
0.006
3
6mer
1385-1398
0.004
4
RP11-354H21.1
hsa-miR-641
0.905

Gene Details
Chromosome: 3
Transcript: ENST00000465795
Biotype: lincRNA
Gene id: ENSG00000244461
Gene Name: RP11-354H21.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
283-309
0.028
2
7mer
109-128
0.015
2
6mer
217-237
0.004
2
CTD-2331D11.4
hsa-miR-641
0.904

Gene Details
Chromosome: 5
Transcript: ENST00000511602
Biotype: lincRNA
Gene id: ENSG00000249842
Gene Name: CTD-2331D11.4
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
688-709
0.032
1
7mer
368-384
0.015
1
XLOC_011100
hsa-miR-641
0.904

Gene Details
Chromosome: chr14
Transcript: TCONS_00022830
Biotype: transcript isomorph
Gene id: XLOC_011100
Gene Name: XLOC_011100
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Liver Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
295-318
0.017
2
6mer
49-70
0.010
6
8mer
770-785
0.008
2
7mer
3248-3265
0.003
2
6mer
1558-1575
0.002
1
6mer
1227-1247
0.002
1
6mer
4079-4103
0.002
2
6mer
6005-6022
0.001
2
7mer
4072-4088
0.001
1
LRRC2-AS1
hsa-miR-641
0.903

Gene Details
Chromosome: 3
Transcript: ENST00000599511
Biotype: antisense
Gene id: ENSG00000268324
Gene Name: LRRC2-AS1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
2238-2263
0.029
1
7mer
171-194
0.019
3
CTA-212A2.3
hsa-miR-641
0.903

Gene Details
Chromosome: 22
Transcript: ENST00000624264
Biotype: lincRNA
Gene id: ENSG00000279217
Gene Name: CTA-212A2.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
5739-5753
0.015
2
7mer
7915-7934
0.006
Not Conserved
9mer
6036-6057
0.005
1
8mer
9273-9290
0.004
1
7mer
2066-2089
0.003
1
6mer
14132-14149
0.003
1
6mer
4438-4460
0.003
3
6mer
8438-8452
0.002
3
8mer
12221-12238
0.002
Not Conserved
6mer
9423-9442
0.002
2
6mer
4755-4770
0.001
2
6mer
5489-5516
0.001
2
RP11-21A7A.3
hsa-miR-641
0.903

Gene Details
Chromosome: 11
Transcript: ENST00000543817
Biotype: antisense
Gene id: ENSG00000256341
Gene Name: RP11-21A7A.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
247-266
0.047
5
AC003075.4
hsa-miR-641
0.902

Gene Details
Chromosome: 7
Transcript: ENST00000419382
Biotype: antisense
Gene id: ENSG00000237773
Gene Name: AC003075.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
53-72
0.026
1
7mer
375-393
0.011
2
7mer
176-202
0.009
2
DYX1C1-CCPG1
hsa-miR-641
0.902

Gene Details
Chromosome: 15
Transcript: ENST00000565113
Biotype: processed_transcript
Gene id: ENSG00000261771
Gene Name: DYX1C1-CCPG1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
528-543
0.011
7
8mer
873-887
0.011
2
6mer
382-400
0.008
8
7mer
1328-1349
0.006
10
6mer
4342-4360
0.005
5
6mer
4506-4527
0.005
4
LINC01182
hsa-miR-641
0.902

Gene Details
Chromosome: 4
Transcript: ENST00000510907
Biotype: lincRNA
Gene id: ENSG00000250634
Gene Name: LINC01182
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
2059-2076
0.018
1
8mer
1778-1801
0.016
1
7mer
1449-1462
0.010
2
6mer
715-727
0.003
1
RP11-1109M24.5
hsa-miR-641
0.901

Gene Details
Chromosome: 17
Transcript: ENST00000577956
Biotype: lincRNA
Gene id: ENSG00000264956
Gene Name: RP11-1109M24.5
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
126-139
0.026
1
8mer
1628-1639
0.012
1
7mer
2100-2123
0.009
1
AC007131.1
hsa-miR-641
0.901

Gene Details
Chromosome: 2
Transcript: ENST00000409590
Biotype: lincRNA
Gene id: ENSG00000222030
Gene Name: AC007131.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
601-626
0.047
11
Funded by: