Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-641

ENST00000418963
Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
AC093690.1
hsa-miR-641
0.543

Gene Details
Chromosome: 2
Transcript: ENST00000418963
Biotype: antisense
Gene id: ENSG00000223522
Gene Name: AC093690.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1097-1118
0.009
1
6mer
741-762
0.003
2
6mer
618-644
0.002
2
Funded by: