Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-641

ENST00000435306
Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
MORF4L2-AS1
hsa-miR-641
0.609

Gene Details
Chromosome: X
Transcript: ENST00000435306
Biotype: antisense
Gene id: ENSG00000231154
Gene Name: MORF4L2-AS1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
1631-1641
0.008
4
7mer
881-900
0.006
2
6mer
1839-1850
0.004
2
Funded by: