Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-641

ENST00000476385
Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
RP11-372E1.4
hsa-miR-641
0.583

Gene Details
Chromosome: 3
Transcript: ENST00000476385
Biotype: antisense
Gene id: ENSG00000243818
Gene Name: RP11-372E1.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Liver Normal/Primary


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
1023-1050
0.008
2
6mer
1664-1680
0.005
2
7mer
1134-1152
0.003
2
Funded by: