Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-641

ENST00000501122
Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
NEAT1
hsa-miR-641
0.962

Gene Details
Chromosome: 11
Transcript: ENST00000501122
Biotype: lincRNA
Gene id: ENSG00000245532
Gene Name: NEAT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
17331-17356
0.012
3
8mer
2544-2557
0.006
1
7mer
15836-15859
0.005
2
7mer
10843-10859
0.004
2
7mer
16417-16440
0.004
2
7mer
14812-14829
0.004
3
7mer
10341-10367
0.003
2
7mer
9326-9345
0.003
2
7mer
8895-8914
0.003
2
6mer
15105-15114
0.002
2
6mer
20555-20576
0.002
3
6mer
13257-13282
0.002
1
7mer
2941-2967
0.002
2
6mer
3415-3429
0.002
2
6mer
18539-18563
0.002
2
6mer
13808-13834
0.002
2
6mer
9796-9812
0.001
1
6mer
17865-17879
0.001
Not Conserved
6mer
2852-2875
0.001
1
6mer
9221-9237
0.001
1
6mer
12801-12825
0.001
1
6mer
14821-14843
0.001
3
6mer
17351-17367
0.001
1
Funded by: