Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-641

ENST00000522771
Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
MEG3
hsa-miR-641
0.710

Gene Details
Chromosome: 14
Transcript: ENST00000522771
Biotype: lincRNA
Gene id: ENSG00000214548
Gene Name: MEG3
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
3207-3223
0.005
8
6mer
116-142
0.004
4
6mer
482-495
0.004
3
7mer
2568-2584
0.004
4
6mer
845-857
0.003
3
6mer
2121-2137
0.002
6
6mer
845-866
0.001
1
6mer
2610-2632
0.001
4
Funded by: