Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-641

ENST00000564206
Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
RP6-24A23.7
hsa-miR-641
0.707

Gene Details
Chromosome: X
Transcript: ENST00000564206
Biotype: sense_overlapping
Gene id: ENSG00000261409
Gene Name: RP6-24A23.7
UCSC graphic:
Expression:
  Cell Line Tissue Category
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1028-1042
0.014
4
6mer
165-184
0.009
10
7mer
2777-2801
0.002
3
Funded by: