Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-641

ENST00000572950
Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
CTD-3088G3.6
hsa-miR-641
0.644

Gene Details
Chromosome: 16
Transcript: ENST00000572950
Biotype: antisense
Gene id: ENSG00000262999
Gene Name: CTD-3088G3.6
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1893-1910
0.014
2
6mer
452-472
0.004
2
6mer
1779-1803
0.003
1
Funded by: