Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-641

ENST00000597346
Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
KCNQ1OT1
hsa-miR-641
0.990

Gene Details
Chromosome: 11
Transcript: ENST00000597346
Biotype: antisense
Gene id: ENSG00000269821
Gene Name: KCNQ1OT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HepG2 Liver Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
67231-67254
0.016
2
7mer
68626-68645
0.011
5
7mer
56558-56580
0.008
7
7mer
75723-75738
0.005
2
7mer
5547-5571
0.005
1
7mer
69251-69271
0.004
2
6mer
52936-52956
0.003
2
7mer
68895-68913
0.003
2
7mer
58150-58166
0.003
1
6mer
44131-44155
0.003
7
6mer
14389-14409
0.003
2
7mer
46701-46723
0.003
2
6mer
86351-86376
0.003
4
6mer
89940-89959
0.003
2
7mer
90363-90386
0.002
1
7mer
86580-86597
0.002
1
6mer
2627-2647
0.002
2
6mer
62360-62381
0.002
2
6mer
46479-46500
0.002
1
6mer
35749-35769
0.002
1
7mer
70959-70982
0.001
2
6mer
81103-81128
0.001
2
6mer
68591-68606
0.001
1
Funded by: