Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-641

ENST00000608694
Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
RP11-448A19.1
hsa-miR-641
0.761

Gene Details
Chromosome: 7
Transcript: ENST00000608694
Biotype: lincRNA
Gene id: ENSG00000273329
Gene Name: RP11-448A19.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
6015-6038
0.013
2
7mer
1142-1157
0.006
1
6mer
6453-6475
0.004
2
7mer
3014-3040
0.003
5
6mer
1688-1709
0.002
2
6mer
2714-2740
0.002
1
6mer
3194-3205
0.001
Not Conserved
Funded by: