Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-641

ENST00000623644
Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
chr22-38_28785274-29006793.1
hsa-miR-641
1.000

Gene Details
Chromosome: 22
Transcript: ENST00000623644
Biotype: lincRNA
Gene id: ENSG00000279978
Gene Name: chr22-38_28785274-29006793.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
37790-37809
0.016
2
7mer
127070-127088
0.016
13
8mer
24427-24446
0.010
1
8mer
8025-8048
0.010
2
7mer
183183-183209
0.010
5
8mer
157312-157325
0.008
3
8mer
49335-49354
0.008
5
8mer
244484-244503
0.007
Not Conserved
7mer
151093-151118
0.007
1
9mer
31731-31755
0.007
Not Conserved
8mer
19974-19998
0.006
2
9mer
78324-78345
0.006
2
6mer
267121-267140
0.006
2
8mer
212337-212358
0.005
1
7mer
28050-28070
0.005
5
7mer
108456-108476
0.005
1
7mer
42709-42725
0.005
2
7mer
89117-89131
0.005
2
7mer
164027-164044
0.005
4
7mer
258963-258977
0.004
1
7mer
106766-106783
0.004
2
7mer
28243-28270
0.004
1
8mer
204334-204360
0.004
2
7mer
153229-153255
0.004
1
7mer
135848-135869
0.004
1
6mer
377-399
0.004
4
7mer
2670-2690
0.004
1
7mer
126212-126221
0.004
4
8mer
75311-75331
0.004
2
7mer
215986-216013
0.004
5
8mer
122137-122157
0.004
1
8mer
9864-9881
0.004
3
7mer
17201-17216
0.003
2
7mer
76318-76344
0.003
1
7mer
12520-12541
0.003
2
7mer
29132-29148
0.003
1
7mer
83277-83300
0.003
2
7mer
132663-132690
0.003
7
7mer
176933-176956
0.003
2
7mer
138187-138204
0.003
1
7mer
131702-131718
0.003
5
7mer
265639-265665
0.003
1
7mer
26957-26981
0.003
3
7mer
49591-49616
0.003
2
7mer
5331-5350
0.003
6
6mer
687-711
0.003
2
6mer
50553-50568
0.003
5
7mer
153918-153937
0.003
Not Conserved
7mer
207101-207127
0.003
2
7mer
210774-210790
0.003
3
7mer
222911-222931
0.003
2
7mer
106224-106240
0.003
1
6mer
155316-155332
0.003
2
6mer
147735-147755
0.003
3
7mer
140594-140618
0.003
3
7mer
147517-147541
0.003
1
7mer
177502-177517
0.003
1
7mer
210050-210069
0.002
1
7mer
132779-132805
0.002
2
6mer
182698-182707
0.002
6
7mer
138506-138521
0.002
1
6mer
166684-166707
0.002
6
6mer
121387-121403
0.002
1
6mer
8902-8918
0.002
1
6mer
221793-221809
0.002
1
7mer
254107-254127
0.002
2
7mer
73694-73706
0.002
1
6mer
137868-137886
0.002
2
6mer
21080-21103
0.002
3
6mer
101930-101950
0.002
3
6mer
244934-244960
0.002
1
6mer
257976-257992
0.002
2
7mer
237550-237572
0.002
2
7mer
207970-207990
0.002
1
6mer
66631-66652
0.002
3
6mer
72785-72804
0.002
2
6mer
110880-110894
0.002
1
6mer
89565-89574
0.002
2
7mer
72463-72480
0.002
2
6mer
144893-144917
0.002
1
6mer
1356-1372
0.002
2
6mer
139724-139735
0.002
2
6mer
198207-198229
0.002
2
6mer
150203-150229
0.002
3
6mer
228369-228389
0.002
1
7mer
37973-37994
0.002
2
6mer
37323-37348
0.002
3
6mer
38574-38596
0.002
2
6mer
107374-107385
0.002
5
6mer
65520-65546
0.002
2
7mer
195956-195971
0.002
4
7mer
210845-210868
0.002
2
6mer
61608-61627
0.002
5
6mer
63306-63316
0.002
5
6mer
78929-78954
0.002
5
6mer
129766-129774
0.002
2
6mer
2318-2336
0.002
2
7mer
244994-245013
0.002
1
6mer
203722-203746
0.002
3
6mer
19680-19691
0.002
2
6mer
216248-216271
0.002
2
6mer
44757-44783
0.002
1
6mer
48554-48569
0.002
2
6mer
108923-108949
0.002
1
6mer
9300-9325
0.002
2
6mer
136739-136765
0.002
1
6mer
251939-251963
0.002
1
6mer
20247-20260
0.002
1
6mer
140027-140051
0.002
2
6mer
5951-5978
0.002
5
6mer
95188-95213
0.002
2
6mer
167441-167465
0.001
2
6mer
181690-181707
0.001
4
6mer
117040-117059
0.001
1
6mer
151231-151245
0.001
2
6mer
58248-58271
0.001
4
6mer
76611-76617
0.001
1
6mer
150338-150354
0.001
5
6mer
93554-93572
0.001
1
6mer
53314-53331
0.001
2
6mer
201069-201095
0.001
1
6mer
80106-80129
0.001
1
6mer
188204-188218
0.001
2
6mer
190822-190837
0.001
1
6mer
28598-28608
0.001
Not Conserved
6mer
164295-164316
0.001
2
6mer
103908-103928
0.001
1
6mer
204819-204839
0.001
2
6mer
128274-128292
0.001
1
6mer
23936-23954
0.001
2
6mer
156959-156980
0.001
2
6mer
42059-42076
0.001
2
6mer
24083-24107
0.001
3
8mer+mismatch
196299-196319
0.001
1
6mer
182100-182119
0.001
2
6mer
112466-112483
0.001
1
6mer
2498-2515
0.001
4
6mer
186862-186872
0.001
2
6mer
148798-148824
0.001
1
7mer
207159-207182
0.001
2
6mer
120794-120807
0.001
Not Conserved
6mer
223031-223049
0.001
2
6mer
140350-140377
0.001
2
6mer
55022-55038
0.001
1
6mer
135952-135977
0.001
3
6mer
221985-222010
0.001
3
6mer
9786-9803
0.001
2
6mer
241239-241261
0.001
2
6mer
251678-251700
0.001
1
6mer
246208-246230
0.001
1
7mer
53355-53374
0.001
Not Conserved
7mer
265658-265673
0.001
2
6mer
215335-215348
0.001
Not Conserved
6mer
156792-156813
0.001
Not Conserved
6mer
132714-132736
0.001
1
6mer
89597-89618
0.001
2
6mer
9367-9382
0.000
1
6mer
120794-120814
0.000
2
Funded by: