Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-641

ENST00000623726
Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
RP5-1014D13.2
hsa-miR-641
0.546

Gene Details
Chromosome: 22
Transcript: ENST00000623726
Biotype: sense_overlapping
Gene id: ENSG00000279738
Gene Name: RP5-1014D13.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
8031-8053
0.004
2
6mer
19095-19115
0.003
2
6mer
1900-1926
0.002
5
7mer
9261-9286
0.002
1
6mer
11917-11938
0.001
3
6mer
15717-15739
0.001
1
6mer
11715-11730
0.001
2
Funded by: