Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-641

NR_037775.1
Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
MIA-RAB4B
hsa-miR-641
0.766

Gene Details
Chromosome: 19
Transcript: NR_037775.1
Biotype: sense
Gene id: NR_037775.1 (gene)
Gene Name: MIA-RAB4B
UCSC graphic: -
Expression:
  Cell Line Tissue Category
LCLBACD2 - Normal/Primary


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
203-223
0.025
7
6mer
1197-1215
0.005
7
Funded by: