Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-641

NR_038864.1
Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
LOC401324
hsa-miR-641
0.697

Gene Details
Chromosome: 7
Transcript: NR_038864.1
Biotype: lincRNA
Gene id: NR_038864.1 (gene)
Gene Name: LOC401324
UCSC graphic: -
Expression: -


miRNA Details
Name: hsa-miR-641
Sequence: aaagacauaggauagagucaccuc
MirBase ID: MIMAT0003311
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
31-54
0.006
2
9mer
1745-1759
0.005
1
6mer
2432-2457
0.003
5
7mer
2868-2886
0.003
2
6mer
653-665
0.003
3
7mer
2541-2554
0.002
2
6mer
1215-1241
0.002
1
Funded by: