Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-642b-3p

ENST00000443093
Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
AC116366.6
hsa-miR-642b-3p
0.419

Gene Details
Chromosome: 5
Transcript: ENST00000443093
Biotype: antisense
Gene id: ENSG00000234290
Gene Name: AC116366.6
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-642b-3p
Sequence: agacacauuuggagagggaccc
MirBase ID: MIMAT0018444
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
2297-2319
0.002
2
7mer
2562-2577
0.002
Not Conserved
6mer
2282-2301
0.001
2
Funded by: