Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-642b-3p

ENST00000489336
Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
CTD-2006C1.2
hsa-miR-642b-3p
0.394

Gene Details
Chromosome: 19
Transcript: ENST00000489336
Biotype: antisense
Gene id: ENSG00000219665
Gene Name: CTD-2006C1.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary


miRNA Details
Name: hsa-miR-642b-3p
Sequence: agacacauuuggagagggaccc
MirBase ID: MIMAT0018444
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
322-337
0.004
Not Conserved
Funded by: