Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-642b-3p

ENST00000501122
Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
NEAT1
hsa-miR-642b-3p
0.760

Gene Details
Chromosome: 11
Transcript: ENST00000501122
Biotype: lincRNA
Gene id: ENSG00000245532
Gene Name: NEAT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary


miRNA Details
Name: hsa-miR-642b-3p
Sequence: agacacauuuggagagggaccc
MirBase ID: MIMAT0018444
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
4659-4682
0.006
2
8mer
12217-12234
0.004
2
7mer
19008-19035
0.003
1
7mer
20503-20517
0.003
2
6mer
9326-9343
0.002
2
7mer
17065-17079
0.002
1
6mer
13527-13542
0.002
2
6mer
12803-12824
0.002
1
7mer
7318-7335
0.002
2
6mer
6643-6668
0.001
1
6mer
21605-21624
0.001
2
6mer
2852-2874
0.001
1
6mer
19169-19196
0.001
2
Funded by: