Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-642b-3p

ENST00000586721
Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
MIR7-3HG
hsa-miR-642b-3p
0.556

Gene Details
Chromosome: 19
Transcript: ENST00000586721
Biotype: lincRNA
Gene id: ENSG00000176840
Gene Name: MIR7-3HG
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant


miRNA Details
Name: hsa-miR-642b-3p
Sequence: agacacauuuggagagggaccc
MirBase ID: MIMAT0018444
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
642-667
0.009
2
6mer
764-781
0.005
4
Funded by: