Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-99b-3p

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
XLOC_008784
hsa-miR-99b-3p
0.783

Gene Details
Chromosome: chr10
Transcript: TCONS_00018486
Biotype: transcript isomorph
Gene id: XLOC_008784
Gene Name: XLOC_008784
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
29-50
0.013
2
7mer
445-466
0.005
1
7mer
380-398
0.004
1
7mer
1108-1133
0.004
Not Conserved
7mer
1175-1188
0.003
1
6mer
1025-1046
0.001
1
7mer
912-927
0.001
Not Conserved
7mer
953-973
0.001
Not Conserved
RP11-680F20.10
hsa-miR-99b-3p
0.782

Gene Details
Chromosome: 11
Transcript: ENST00000569238
Biotype: lincRNA
Gene id: ENSG00000260209
Gene Name: RP11-680F20.10
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
78-94
0.017
1
6mer
99-125
0.015
1
RP11-210M15.2
hsa-miR-99b-3p
0.781

Gene Details
Chromosome: 15
Transcript: ENST00000559008
Biotype: lincRNA
Gene id: ENSG00000259495
Gene Name: RP11-210M15.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary
Fibroblasts Lung Normal/Primary
A549 Lung Cancer/Malignant
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
80-98
0.024
2
7mer
6398-6425
0.004
3
6mer
3363-3376
0.002
2
6mer
2790-2816
0.001
2
XLOC_008328
hsa-miR-99b-3p
0.780

Gene Details
Chromosome: chrY
Transcript: TCONS_00017652
Biotype: transcript isomorph
Gene id: XLOC_008328
Gene Name: XLOC_008328
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
- Heart Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
158-183
0.017
1
6mer
367-387
0.015
1
RP1-309I22.2
hsa-miR-99b-3p
0.778

Gene Details
Chromosome: 22
Transcript: ENST00000624184
Biotype: sense_overlapping
Gene id: ENSG00000279338
Gene Name: RP1-309I22.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
28384-28404
0.004
Not Conserved
6mer
28748-28774
0.003
2
7mer
20798-20815
0.003
3
6mer
16056-16078
0.003
5
6mer
25028-25052
0.002
8
6mer
679-702
0.002
4
7mer
4336-4354
0.002
2
6mer
19302-19321
0.002
1
7mer
27383-27400
0.002
4
6mer
22708-22718
0.002
6
6mer
23525-23550
0.002
4
6mer
26807-26827
0.001
2
6mer
14333-14352
0.001
4
6mer
6209-6224
0.001
2
6mer
23367-23389
0.001
2
AC079466.1
hsa-miR-99b-3p
0.778

Gene Details
Chromosome: 19
Transcript: ENST00000587961
Biotype: lincRNA
Gene id: ENSG00000266976
Gene Name: AC079466.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
27-49
0.010
1
6mer
3536-3550
0.008
2
6mer
244-263
0.006
1
6mer
2725-2746
0.005
2
6mer
884-898
0.002
1
XLOC_010671
hsa-miR-99b-3p
0.778

Gene Details
Chromosome: chr13
Transcript: TCONS_00022066
Biotype: transcript isomorph
Gene id: XLOC_010671
Gene Name: XLOC_010671
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
41-67
0.018
1
6mer
186-202
0.014
1
AC009948.5
hsa-miR-99b-3p
0.778

Gene Details
Chromosome: 2
Transcript: ENST00000442036
Biotype: antisense
Gene id: ENSG00000223960
Gene Name: AC009948.5
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
20-46
0.017
3
7mer
455-475
0.014
2
LINC00836
hsa-miR-99b-3p
0.776

Gene Details
Chromosome: 10
Transcript: NR_108068.1
Biotype: lincRNA
Gene id: NR_108068.1 (gene)
Gene Name: LINC00836
UCSC graphic: -
Expression: -


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
33-52
0.027
2
6mer
1143-1164
0.004
1
AC015849.12
hsa-miR-99b-3p
0.774

Gene Details
Chromosome: 17
Transcript: ENST00000605738
Biotype: lincRNA
Gene id: ENSG00000270829
Gene Name: AC015849.12
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
383-402
0.031
5
XLOC_013732
hsa-miR-99b-3p
0.772

Gene Details
Chromosome: chr20
Transcript: TCONS_00028662
Biotype: transcript isomorph
Gene id: XLOC_013732
Gene Name: XLOC_013732
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
- Liver Normal/Primary
HepG2 Liver Cancer/Malignant
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1609-1634
0.027
2
6mer
525-544
0.004
2
RP11-255H23.4
hsa-miR-99b-3p
0.769

Gene Details
Chromosome: 19
Transcript: ENST00000599944
Biotype: lincRNA
Gene id: ENSG00000267924
Gene Name: RP11-255H23.4
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
275-296
0.021
Not Conserved
8mer
124-139
0.010
1
LINC00702
hsa-miR-99b-3p
0.765

Gene Details
Chromosome: 10
Transcript: ENST00000608792
Biotype: lincRNA
Gene id: ENSG00000233117
Gene Name: LINC00702
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
4266-4289
0.015
2
6mer
6078-6094
0.006
2
6mer
138-165
0.004
1
6mer
3374-3399
0.002
3
7mer
4974-5000
0.001
1
6mer
2511-2529
0.001
Not Conserved
XLOC_009983
hsa-miR-99b-3p
0.764

Gene Details
Chromosome: chr12
Transcript: TCONS_00020678
Biotype: transcript isomorph
Gene id: XLOC_009983
Gene Name: XLOC_009983
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Liver Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
1058-1077
0.016
10
7mer
760-787
0.014
1
RP11-436I24.1
hsa-miR-99b-3p
0.762

Gene Details
Chromosome: 6
Transcript: NR_027113.2
Biotype: antisense
Gene id: NR_027113.2 (gene)
Gene Name: RP11-436I24.1
UCSC graphic: -
Expression: -


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
1620-1639
0.030
1
XLOC_004848
hsa-miR-99b-3p
0.760

Gene Details
Chromosome: chr5
Transcript: TCONS_00010939
Biotype: transcript isomorph
Gene id: XLOC_004848
Gene Name: XLOC_004848
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Brain Normal/Primary
- Breast Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary
- Lung Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
332-353
0.030
5
RP11-388P9.2
hsa-miR-99b-3p
0.757

Gene Details
Chromosome: 10
Transcript: ENST00000414383
Biotype: antisense
Gene id: ENSG00000232682
Gene Name: RP11-388P9.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
165-188
0.024
5
6mer
405-420
0.005
5
PWARSN
hsa-miR-99b-3p
0.755

Gene Details
Chromosome: 15
Transcript: NR_022011.1
Biotype: sense
Gene id: NR_022011.1 (gene)
Gene Name: PWARSN
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
36-54
0.021
5
6mer
1648-1657
0.005
2
6mer
1353-1378
0.003
1
RP11-382D12.1
hsa-miR-99b-3p
0.753

Gene Details
Chromosome: 1
Transcript: ENST00000449525
Biotype: lincRNA
Gene id: ENSG00000231791
Gene Name: RP11-382D12.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
295-311
0.029
1
TPT1-AS1
hsa-miR-99b-3p
0.752

Gene Details
Chromosome: 13
Transcript: ENST00000517509
Biotype: antisense
Gene id: ENSG00000170919
Gene Name: TPT1-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
HREpiC Kidney Normal/Primary
- Liver Normal/Primary
HepG2 Liver Cancer/Malignant
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
- Lymph Node Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
3421-3446
0.019
4
6mer
432-449
0.002
1
6mer
565-591
0.002
1
6mer
706-732
0.002
1
6mer
782-808
0.002
1
6mer
936-953
0.001
1
Funded by: