Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-99b-3p

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
RP11-85G18.6
hsa-miR-99b-3p
0.751

Gene Details
Chromosome: 10
Transcript: ENST00000574842
Biotype: lincRNA
Gene id: ENSG00000262412
Gene Name: RP11-85G18.6
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
943-963
0.029
2
LINC00960
hsa-miR-99b-3p
0.750

Gene Details
Chromosome: 3
Transcript: ENST00000492922
Biotype: lincRNA
Gene id: ENSG00000242516
Gene Name: LINC00960
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
1946-1966
0.016
2
6mer
347-369
0.013
2
PCBP2-OT1
hsa-miR-99b-3p
0.747

Gene Details
Chromosome: 12
Transcript: NR_109828.1
Biotype: sense
Gene id: NR_109828.1 (gene)
Gene Name: PCBP2-OT1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
304-326
0.028
10
CTA-292E10.9
hsa-miR-99b-3p
0.745

Gene Details
Chromosome: 22
Transcript: ENST00000623127
Biotype: antisense
Gene id: ENSG00000280111
Gene Name: CTA-292E10.9
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
1729-1751
0.007
8
6mer
259-275
0.007
4
6mer
4532-4549
0.002
8
6mer
4200-4213
0.002
2
6mer
11190-11211
0.002
10
6mer
18626-18642
0.001
2
6mer
11100-11123
0.001
4
6mer
18091-18104
0.001
2
6mer
6983-7003
0.001
1
6mer
21311-21334
0.001
1
6mer
16488-16502
0.001
2
6mer
22854-22879
0.001
1
7mer
20891-20913
0.001
1
XLOC_009313
hsa-miR-99b-3p
0.743

Gene Details
Chromosome: chr11
Transcript: TCONS_00019513
Biotype: transcript isomorph
Gene id: XLOC_009313
Gene Name: XLOC_009313
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
- Brain Normal/Primary
HeLa Cervix Cancer/Malignant
- Testes Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
720-740
0.022
1
7mer
32-58
0.006
1
SC22CB-109E1.1
hsa-miR-99b-3p
0.743

Gene Details
Chromosome: 22
Transcript: ENST00000623290
Biotype: lincRNA
Gene id: ENSG00000279582
Gene Name: SC22CB-109E1.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
10041-10064
0.008
2
6mer
67-92
0.007
2
6mer
694-716
0.004
2
6mer
1178-1194
0.002
2
6mer
2226-2252
0.002
2
6mer
3775-3786
0.002
2
6mer
6894-6915
0.002
2
RP11-46A10.5
hsa-miR-99b-3p
0.739

Gene Details
Chromosome: 1
Transcript: ENST00000358073
Biotype: antisense
Gene id: ENSG00000243155
Gene Name: RP11-46A10.5
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
2065-2084
0.028
1
MIR3184
hsa-miR-99b-3p
0.738

Gene Details
Chromosome: 17
Transcript: ENST00000586878
Biotype: sense_intronic
Gene id: ENSG00000266919
Gene Name: MIR3184
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
53-70
0.028
10
MALAT1
hsa-miR-99b-3p
0.737

Gene Details
Chromosome: 11
Transcript: ENST00000534336
Biotype: lincRNA
Gene id: ENSG00000251562
Gene Name: MALAT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
8542-8564
0.011
1
7mer
3998-4017
0.007
8
6mer
7202-7219
0.003
7
6mer
4799-4812
0.002
2
6mer
2285-2311
0.002
2
6mer
7844-7865
0.002
1
6mer
4377-4400
0.002
1
7mer
1321-1336
0.001
1
RP11-946L20.2
hsa-miR-99b-3p
0.737

Gene Details
Chromosome: 8
Transcript: ENST00000524283
Biotype: lincRNA
Gene id: ENSG00000253877
Gene Name: RP11-946L20.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
- Brain Normal/Primary
- Lung Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
415-440
0.028
1
LINC00836
hsa-miR-99b-3p
0.735

Gene Details
Chromosome: 10
Transcript: NR_108067.1
Biotype: lincRNA
Gene id: NR_108067.1 (gene)
Gene Name: LINC00836
UCSC graphic: -
Expression: -


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
33-52
0.024
2
6mer
1404-1425
0.004
1
RP11-135A1.2
hsa-miR-99b-3p
0.734

Gene Details
Chromosome: 3
Transcript: ENST00000418353
Biotype: antisense
Gene id: ENSG00000232874
Gene Name: RP11-135A1.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
- Kidney Normal/Primary
Fibroblasts Lung Normal/Primary
- Prostate Normal/Primary


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
367-392
0.014
Not Conserved
6mer
23-42
0.010
2
6mer
180-202
0.003
2
XLOC_004205
hsa-miR-99b-3p
0.732

Gene Details
Chromosome: chr4
Transcript: TCONS_00008689
Biotype: transcript isomorph
Gene id: XLOC_004205
Gene Name: XLOC_004205
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
4865-4885
0.025
2
6mer
2891-2910
0.002
2
RP11-218M22.1
hsa-miR-99b-3p
0.730

Gene Details
Chromosome: 12
Transcript: ENST00000537514
Biotype: antisense
Gene id: ENSG00000177406
Gene Name: RP11-218M22.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
2300-2323
0.022
3
6mer
198-215
0.005
3
XLOC_011484
hsa-miR-99b-3p
0.730

Gene Details
Chromosome: chr15
Transcript: TCONS_00023685
Biotype: transcript isomorph
Gene id: XLOC_011484
Gene Name: XLOC_011484
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
Fibroblasts Foreskin Normal/Primary
- Kidney Normal/Primary
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
2658-2671
0.012
1
6mer
1548-1568
0.007
1
7mer
1028-1050
0.007
1
XLOC_011179
hsa-miR-99b-3p
0.729

Gene Details
Chromosome: chr15
Transcript: TCONS_00023310
Biotype: transcript isomorph
Gene id: XLOC_011179
Gene Name: XLOC_011179
UCSC graphic: -
Expression:
  Cell Line Tissue Category
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
- Kidney Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
- Ovary Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
33-54
0.027
2
RP11-111F5.4
hsa-miR-99b-3p
0.728

Gene Details
Chromosome: 9
Transcript: ENST00000377518
Biotype: retained_intron
Gene id: ENSG00000204802
Gene Name: RP11-111F5.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
70-85
0.014
1
6mer
639-664
0.013
1
RP11-378J18.8
hsa-miR-99b-3p
0.727

Gene Details
Chromosome: 1
Transcript: ENST00000608771
Biotype: antisense
Gene id: ENSG00000272750
Gene Name: RP11-378J18.8
UCSC graphic:
Expression:
  Cell Line Tissue Category
HeLa Cervix Cancer/Malignant


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
873-887
0.022
8
6mer
483-499
0.004
1
RP11-19D2.2
hsa-miR-99b-3p
0.727

Gene Details
Chromosome: 20
Transcript: ENST00000569178
Biotype: lincRNA
Gene id: ENSG00000261249
Gene Name: RP11-19D2.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
234-255
0.016
4
6mer
113-127
0.007
2
6mer
745-764
0.004
1
XLOC_001506
hsa-miR-99b-3p
0.727

Gene Details
Chromosome: chr2
Transcript: TCONS_00002704
Biotype: transcript isomorph
Gene id: XLOC_001506
Gene Name: XLOC_001506
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
281-306
0.021
8
7mer
306-331
0.006
1
Funded by: