Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-99b-3p

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
SDCBP2-AS1
hsa-miR-99b-3p
0.725

Gene Details
Chromosome: 20
Transcript: ENST00000609285
Biotype: antisense
Gene id: ENSG00000234684
Gene Name: SDCBP2-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
173-199
0.027
3
RP5-1073O3.2
hsa-miR-99b-3p
0.725

Gene Details
Chromosome: 1
Transcript: ENST00000429398
Biotype: antisense
Gene id: ENSG00000231128
Gene Name: RP5-1073O3.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
62-85
0.027
6
XLOC_013161
hsa-miR-99b-3p
0.722

Gene Details
Chromosome: chr19
Transcript: TCONS_00027629
Biotype: transcript isomorph
Gene id: XLOC_013161
Gene Name: XLOC_013161
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
- Breast Normal/Primary
- Kidney Normal/Primary
- Ovary Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
62-89
0.026
1
MIR6818
hsa-miR-99b-3p
0.720

Gene Details
Chromosome: 22
Transcript: ENST00000624945
Biotype: antisense
Gene id: ENSG00000279159
Gene Name: MIR6818
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
37121-37135
0.003
3
6mer
46302-46328
0.003
5
6mer
33580-33595
0.002
9
7mer
26978-27001
0.002
2
6mer
38671-38690
0.002
3
6mer
48321-48344
0.002
2
7mer
46798-46825
0.002
6
6mer
12763-12776
0.002
2
6mer
7162-7188
0.002
3
6mer
43378-43391
0.001
4
6mer
7667-7690
0.001
2
6mer
27644-27664
0.001
2
6mer
35603-35626
0.001
1
6mer
46881-46906
0.001
4
6mer
38593-38613
0.001
6
6mer
46853-46873
0.001
7
RP11-1085N6.3
hsa-miR-99b-3p
0.719

Gene Details
Chromosome: 14
Transcript: ENST00000554597
Biotype: antisense
Gene id: ENSG00000259133
Gene Name: RP11-1085N6.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
285-311
0.017
3
6mer
53-78
0.009
10
XLOC_008416
hsa-miR-99b-3p
0.715

Gene Details
Chromosome: chr10
Transcript: TCONS_00017799
Biotype: transcript isomorph
Gene id: XLOC_008416
Gene Name: XLOC_008416
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Brain Normal/Primary


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
12-31
0.026
2
LINC01123
hsa-miR-99b-3p
0.714

Gene Details
Chromosome: 2
Transcript: NR_046111.1
Biotype: lincRNA
Gene id: NR_046111.1 (gene)
Gene Name: LINC01123
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
2258-2277
0.011
1
6mer
2272-2292
0.007
2
6mer
850-867
0.004
4
7mer
1972-1988
0.004
1
LINC01123
hsa-miR-99b-3p
0.712

Gene Details
Chromosome: 2
Transcript: ENST00000419296
Biotype: lincRNA
Gene id: ENSG00000204588
Gene Name: LINC01123
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
2360-2379
0.011
1
6mer
2374-2394
0.007
2
6mer
767-784
0.004
4
7mer
2074-2090
0.003
1
RP1-34P24.3
hsa-miR-99b-3p
0.711

Gene Details
Chromosome: 22
Transcript: ENST00000623446
Biotype: lincRNA
Gene id: ENSG00000280199
Gene Name: RP1-34P24.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
1868-1878
0.002
1
6mer
1829-1845
0.002
1
6mer
1730-1746
0.002
1
6mer
1664-1680
0.002
1
6mer
1697-1713
0.001
1
6mer
1598-1614
0.001
1
6mer
1505-1515
0.001
1
6mer
1763-1779
0.001
Not Conserved
6mer
1208-1218
0.001
2
6mer
1466-1482
0.001
1
6mer
1532-1548
0.001
1
6mer
1796-1812
0.001
Not Conserved
6mer
1571-1581
0.001
Not Conserved
6mer
1400-1416
0.001
1
6mer
1367-1383
0.001
1
6mer
1631-1647
0.001
Not Conserved
6mer
1241-1251
0.001
1
6mer
1169-1185
0.001
Not Conserved
6mer
1301-1317
0.001
1
6mer
1433-1449
0.001
Not Conserved
6mer
1334-1350
0.001
Not Conserved
6mer
1268-1284
0.001
Not Conserved
RP11-65L19.4
hsa-miR-99b-3p
0.710

Gene Details
Chromosome: 13
Transcript: ENST00000606916
Biotype: lincRNA
Gene id: ENSG00000272329
Gene Name: RP11-65L19.4
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
917-940
0.014
1
7mer
616-641
0.011
2
XLOC_001198
hsa-miR-99b-3p
0.709

Gene Details
Chromosome: chr1
Transcript: TCONS_00001814
Biotype: transcript isomorph
Gene id: XLOC_001198
Gene Name: XLOC_001198
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
407-425
0.013
4
6mer
386-407
0.007
3
6mer
568-587
0.005
2
XLOC_008295
hsa-miR-99b-3p
0.707

Gene Details
Chromosome: chrY
Transcript: TCONS_00017578
Biotype: transcript isomorph
Gene id: XLOC_008295
Gene Name: XLOC_008295
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
HUVEC Blood Vessel Normal/Primary
- Brain Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
- Liver Normal/Primary
A549 Lung Cancer/Malignant
Fibroblasts Lung Normal/Primary
- Lung Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
4779-4804
0.010
1
6mer
3262-3271
0.005
1
6mer
2034-2055
0.005
1
6mer
2151-2159
0.004
1
RP1-111C20.4
hsa-miR-99b-3p
0.707

Gene Details
Chromosome: 6
Transcript: ENST00000607391
Biotype: antisense
Gene id: ENSG00000271913
Gene Name: RP1-111C20.4
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
161-179
0.025
2
XLOC_003384
hsa-miR-99b-3p
0.707

Gene Details
Chromosome: chr3
Transcript: TCONS_00006752
Biotype: transcript isomorph
Gene id: XLOC_003384
Gene Name: XLOC_003384
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Breast Normal/Primary
- Heart Normal/Primary
- Lung Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
2374-2395
0.016
3
6mer
2276-2299
0.005
2
6mer
490-507
0.004
4
TTTY15
hsa-miR-99b-3p
0.706

Gene Details
Chromosome: Y
Transcript: ENST00000440408
Biotype: lincRNA
Gene id: ENSG00000233864
Gene Name: TTTY15
UCSC graphic:
Expression:
  Cell Line Tissue Category
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
4779-4804
0.010
1
6mer
3262-3271
0.005
1
6mer
2034-2055
0.005
1
6mer
2151-2159
0.004
1
AC012593.1
hsa-miR-99b-3p
0.706

Gene Details
Chromosome: 2
Transcript: ENST00000588944
Biotype: lincRNA
Gene id: ENSG00000226994
Gene Name: AC012593.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
814-831
0.017
2
7mer
674-699
0.008
1
TTTY15
hsa-miR-99b-3p
0.705

Gene Details
Chromosome: Y
Transcript: NR_001545.2
Biotype: lincRNA
Gene id: NR_001545.2 (gene)
Gene Name: TTTY15
UCSC graphic: -
Expression:
  Cell Line Tissue Category
HUVEC Blood Vessel Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
4746-4771
0.010
1
6mer
3229-3238
0.005
1
6mer
2001-2022
0.005
1
6mer
2118-2126
0.004
1
XLOC_006092
hsa-miR-99b-3p
0.704

Gene Details
Chromosome: chr7
Transcript: TCONS_00014132
Biotype: transcript isomorph
Gene id: XLOC_006092
Gene Name: XLOC_006092
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary
- Ovary Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
528-553
0.019
2
6mer
209-225
0.006
1
MMP24-AS1
hsa-miR-99b-3p
0.704

Gene Details
Chromosome: 20
Transcript: ENST00000435366
Biotype: antisense
Gene id: ENSG00000126005
Gene Name: MMP24-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer+wobble
43-68
0.019
4
6mer
286-309
0.006
8
LL22NC03-86G7.1
hsa-miR-99b-3p
0.702

Gene Details
Chromosome: 22
Transcript: ENST00000458178
Biotype: antisense
Gene id: ENSG00000224086
Gene Name: LL22NC03-86G7.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
18825-18844
0.007
9
6mer
37697-37723
0.004
1
6mer
32837-32858
0.002
9
7mer
15322-15341
0.002
2
6mer
18073-18094
0.001
1
6mer
28455-28469
0.001
2
6mer
31120-31144
0.001
3
6mer
8745-8765
0.001
2
6mer
26160-26185
0.001
2
7mer
32878-32890
0.001
4
6mer
33021-33045
0.001
2
6mer
4070-4095
0.001
1
6mer
18209-18234
0.001
Not Conserved
6mer
19299-19324
0.001
2
6mer
8811-8835
0.000
2
Funded by: