Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-99b-3p

ENST00000439232
Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
SNORA71B
hsa-miR-99b-3p
0.420

Gene Details
Chromosome: 20
Transcript: ENST00000439232
Biotype: lincRNA
Gene id: ENSG00000235408
Gene Name: SNORA71B
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
12-27
0.005
5
Funded by: