Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-99b-3p

ENST00000558749
Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
RP11-356M20.3
hsa-miR-99b-3p
0.443

Gene Details
Chromosome: 15
Transcript: ENST00000558749
Biotype: sense_intronic
Gene id: ENSG00000259735
Gene Name: RP11-356M20.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
A549 Lung Cancer/Malignant
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
412-437
0.004
2
6mer
28-48
0.003
1
Funded by: