Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-99b-3p

ENST00000597346
Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
KCNQ1OT1
hsa-miR-99b-3p
0.944

Gene Details
Chromosome: 11
Transcript: ENST00000597346
Biotype: antisense
Gene id: ENSG00000269821
Gene Name: KCNQ1OT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HepG2 Liver Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
8052-8075
0.012
1
7mer
73838-73862
0.005
4
7mer
76049-76066
0.003
1
7mer
53530-53552
0.002
1
6mer
19184-19201
0.002
2
6mer
45096-45117
0.002
2
6mer
13210-13232
0.002
2
6mer
26844-26866
0.002
1
6mer
33298-33323
0.002
1
6mer
78010-78025
0.002
2
7mer
61589-61611
0.002
1
6mer
24128-24147
0.002
2
7mer
55651-55673
0.001
4
6mer
19659-19682
0.001
2
6mer
58442-58465
0.001
2
6mer
84563-84585
0.001
2
6mer
43639-43650
0.001
2
7mer
55514-55540
0.001
3
6mer
66533-66547
0.001
1
6mer
64886-64905
0.001
3
6mer
86669-86691
0.001
3
6mer
83101-83122
0.001
2
6mer
58594-58619
0.001
2
6mer
56739-56760
0.001
1
6mer
80903-80920
0.001
2
6mer
82679-82701
0.001
2
6mer
65450-65467
0.001
1
6mer
17293-17313
0.001
2
6mer
56337-56361
0.001
2
6mer
56661-56681
0.001
5
6mer
56721-56747
0.000
2
Funded by: