Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-99b-3p

ENST00000614612
Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
RP11-272L14.2
hsa-miR-99b-3p
0.561

Gene Details
Chromosome: 13
Transcript: ENST00000614612
Biotype: sense_intronic
Gene id: ENSG00000274204
Gene Name: RP11-272L14.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
403-419
0.008
7
6mer
461-479
0.004
2
6mer
595-610
0.003
2
Funded by: