Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-99b-3p

ENST00000623127
Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
CTA-292E10.9
hsa-miR-99b-3p
0.745

Gene Details
Chromosome: 22
Transcript: ENST00000623127
Biotype: antisense
Gene id: ENSG00000280111
Gene Name: CTA-292E10.9
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
1729-1751
0.007
8
6mer
259-275
0.007
4
6mer
4532-4549
0.002
8
6mer
4200-4213
0.002
2
6mer
11190-11211
0.002
10
6mer
18626-18642
0.001
2
6mer
11100-11123
0.001
4
6mer
18091-18104
0.001
2
6mer
6983-7003
0.001
1
6mer
21311-21334
0.001
1
6mer
16488-16502
0.001
2
6mer
22854-22879
0.001
1
7mer
20891-20913
0.001
1
Funded by: