Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-99b-3p

NR_109777.1
Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
LOC100506281
hsa-miR-99b-3p
0.361

Gene Details
Chromosome: 16
Transcript: NR_109777.1
Biotype: antisense
Gene id: NR_109777.1 (gene)
Gene Name: LOC100506281
UCSC graphic: -
Expression: -


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
373-394
0.001
1
Funded by: