Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-99b-3p

TCONS_00025499
Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
XLOC_012314
hsa-miR-99b-3p
0.574

Gene Details
Chromosome: chr17
Transcript: TCONS_00025499
Biotype: transcript isomorph
Gene id: XLOC_012314
Gene Name: XLOC_012314
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
131-148
0.011
5
6mer
136-156
0.004
2
Funded by: