Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-99b-3p

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
XLOC_009532
hsa-miR-99b-3p
0.872

Gene Details
Chromosome: chr11
Transcript: TCONS_00019739
Biotype: transcript isomorph
Gene id: XLOC_009532
Gene Name: XLOC_009532
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Kidney Normal/Primary
- Lung Normal/Primary


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
54-80
0.042
2
HOXC-AS1
hsa-miR-99b-3p
0.870

Gene Details
Chromosome: 12
Transcript: ENST00000505700
Biotype: antisense
Gene id: ENSG00000250451
Gene Name: HOXC-AS1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
244-263
0.025
5
6mer
38-63
0.016
8
RP11-1085N6.3
hsa-miR-99b-3p
0.862

Gene Details
Chromosome: 14
Transcript: ENST00000556696
Biotype: antisense
Gene id: ENSG00000259133
Gene Name: RP11-1085N6.3
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
24-42
0.023
3
7mer
293-319
0.018
3
RP11-401H2.1
hsa-miR-99b-3p
0.849

Gene Details
Chromosome: 8
Transcript: ENST00000521294
Biotype: antisense
Gene id: ENSG00000253664
Gene Name: RP11-401H2.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
448-468
0.026
2
6mer
272-292
0.013
6
RP11-111F5.8
hsa-miR-99b-3p
0.849

Gene Details
Chromosome: 9
Transcript: ENST00000428709
Biotype: lincRNA
Gene id: ENSG00000233651
Gene Name: RP11-111F5.8
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
3006-3020
0.037
1
6mer
942-956
0.002
Not Conserved
CTA-796E4.5
hsa-miR-99b-3p
0.847

Gene Details
Chromosome: 22
Transcript: ENST00000624243
Biotype: lincRNA
Gene id: ENSG00000280065
Gene Name: CTA-796E4.5
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
24439-24464
0.004
2
7mer
28216-28238
0.004
1
6mer
30585-30604
0.004
2
7mer
12183-12205
0.004
2
7mer
21817-21841
0.003
1
8mer
8494-8511
0.003
2
7mer
9930-9944
0.003
1
6mer
25867-25892
0.002
2
6mer
7224-7248
0.002
5
6mer
925-949
0.002
Not Conserved
6mer
5026-5049
0.002
2
6mer
13701-13719
0.002
2
6mer
17042-17061
0.002
3
6mer
2625-2652
0.001
2
6mer
22261-22284
0.001
2
6mer
16281-16306
0.001
2
RP3-340N1.2
hsa-miR-99b-3p
0.847

Gene Details
Chromosome: 1
Transcript: ENST00000431027
Biotype: lincRNA
Gene id: ENSG00000227066
Gene Name: RP3-340N1.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
871-885
0.019
2
6mer
321-347
0.014
2
6mer
1708-1734
0.003
1
6mer
1418-1441
0.003
1
AC004637.1
hsa-miR-99b-3p
0.845

Gene Details
Chromosome: 19
Transcript: ENST00000586675
Biotype: antisense
Gene id: ENSG00000267304
Gene Name: AC004637.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
336-361
0.038
1
DNAH17-AS1
hsa-miR-99b-3p
0.844

Gene Details
Chromosome: 17
Transcript: ENST00000591373
Biotype: antisense
Gene id: ENSG00000267432
Gene Name: DNAH17-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HeLa Cervix Cancer/Malignant


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
40-61
0.033
1
6mer
705-718
0.003
6
6mer
1302-1328
0.002
1
XLOC_008878
hsa-miR-99b-3p
0.842

Gene Details
Chromosome: chr10
Transcript: TCONS_00017740
Biotype: transcript isomorph
Gene id: XLOC_008878
Gene Name: XLOC_008878
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
- Brain Normal/Primary
- Colon Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
- Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
58-85
0.024
1
6mer
38-58
0.014
1
CTD-2541M15.1
hsa-miR-99b-3p
0.833

Gene Details
Chromosome: 8
Transcript: ENST00000515608
Biotype: antisense
Gene id: ENSG00000249898
Gene Name: CTD-2541M15.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
1900-1923
0.030
2
6mer
202-226
0.005
1
7mer
1386-1405
0.002
2
XLOC_001441
hsa-miR-99b-3p
0.832

Gene Details
Chromosome: chr2
Transcript: TCONS_00002697
Biotype: transcript isomorph
Gene id: XLOC_001441
Gene Name: XLOC_001441
UCSC graphic: -
Expression:
  Cell Line Tissue Category
HeLa Cervix Cancer/Malignant
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
319-344
0.026
1
7mer
2335-2361
0.008
2
6mer
1119-1133
0.003
5
RP11-813F20.2
hsa-miR-99b-3p
0.832

Gene Details
Chromosome: 18
Transcript: ENST00000591105
Biotype: lincRNA
Gene id: ENSG00000267674
Gene Name: RP11-813F20.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
170-186
0.037
Not Conserved
TFAP2A-AS1
hsa-miR-99b-3p
0.831

Gene Details
Chromosome: 6
Transcript: ENST00000420777
Biotype: antisense
Gene id: ENSG00000229950
Gene Name: TFAP2A-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
HeLa Cervix Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
83-105
0.035
3
6mer
935-958
0.002
3
DLX6-AS1
hsa-miR-99b-3p
0.831

Gene Details
Chromosome: 7
Transcript: ENST00000430027
Biotype: antisense
Gene id: ENSG00000231764
Gene Name: DLX6-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant
HepG2 Liver Cancer/Malignant


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
15316-15338
0.008
7
6mer
29-45
0.008
5
6mer
14611-14627
0.003
6
6mer
12934-12955
0.003
6
6mer
7004-7026
0.002
3
6mer
14741-14759
0.002
2
6mer
14707-14729
0.002
2
6mer
14724-14747
0.002
1
6mer
1793-1814
0.002
3
6mer
12244-12266
0.002
1
6mer
3451-3468
0.001
1
6mer
9212-9231
0.001
2
LINC00507
hsa-miR-99b-3p
0.829

Gene Details
Chromosome: 12
Transcript: ENST00000540882
Biotype: lincRNA
Gene id: ENSG00000256193
Gene Name: LINC00507
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
30-52
0.030
6
7mer
250-275
0.007
2
CTA-544A11.1
hsa-miR-99b-3p
0.829

Gene Details
Chromosome: 22
Transcript: ENST00000624411
Biotype: antisense
Gene id: ENSG00000279802
Gene Name: CTA-544A11.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
409-431
0.012
2
9mer
9009-9024
0.010
1
6mer
4-28
0.006
4
6mer
5366-5379
0.002
2
6mer
5895-5919
0.002
2
6mer
808-834
0.002
2
6mer
3719-3741
0.002
3
TFAP2A-AS1
hsa-miR-99b-3p
0.829

Gene Details
Chromosome: 6
Transcript: NR_033910.1
Biotype: antisense
Gene id: NR_033910.1 (gene)
Gene Name: TFAP2A-AS1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
HeLa Cervix Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
75-97
0.034
3
6mer
941-964
0.003
3
TFAP2A-AS1
hsa-miR-99b-3p
0.829

Gene Details
Chromosome: 6
Transcript: ENST00000443546
Biotype: antisense
Gene id: ENSG00000229950
Gene Name: TFAP2A-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
HeLa Cervix Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
128-150
0.036
3
XLOC_011488
hsa-miR-99b-3p
0.827

Gene Details
Chromosome: chr15
Transcript: TCONS_00023279
Biotype: transcript isomorph
Gene id: XLOC_011488
Gene Name: XLOC_011488
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
- Brain Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
A549 Lung Cancer/Malignant
- Ovary Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
690-707
0.025
Not Conserved
6mer
981-1005
0.006
2
6mer
85-103
0.005
2
Funded by: