Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-99b-3p

Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
RP11-30K9.6
hsa-miR-99b-3p
0.825

Gene Details
Chromosome: 15
Transcript: ENST00000500929
Biotype: lincRNA
Gene id: ENSG00000245975
Gene Name: RP11-30K9.6
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
692-709
0.025
Not Conserved
6mer
983-1007
0.006
2
6mer
87-105
0.005
2
AC034228.4
hsa-miR-99b-3p
0.820

Gene Details
Chromosome: 5
Transcript: ENST00000446275
Biotype: antisense
Gene id: ENSG00000234758
Gene Name: AC034228.4
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
317-335
0.035
3
XLOC_003210
hsa-miR-99b-3p
0.820

Gene Details
Chromosome: chr3
Transcript: TCONS_00006603
Biotype: transcript isomorph
Gene id: XLOC_003210
Gene Name: XLOC_003210
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
305-320
0.021
5
7mer
352-378
0.015
3
RP11-388P9.2
hsa-miR-99b-3p
0.817

Gene Details
Chromosome: 10
Transcript: ENST00000619719
Biotype: antisense
Gene id: ENSG00000232682
Gene Name: RP11-388P9.2
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
91-114
0.029
5
6mer
331-346
0.006
5
RP3-323A16.1
hsa-miR-99b-3p
0.816

Gene Details
Chromosome: 22
Transcript: ENST00000623959
Biotype: antisense
Gene id: ENSG00000279184
Gene Name: RP3-323A16.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
44654-44678
0.005
2
7mer
45009-45029
0.004
2
7mer
20129-20154
0.004
2
7mer
52052-52079
0.003
2
6mer
51092-51115
0.003
2
6mer
46024-46048
0.002
3
7mer
35707-35734
0.002
2
6mer
4533-4552
0.001
1
6mer
48853-48880
0.001
2
6mer
39568-39588
0.001
2
6mer
42611-42626
0.001
2
6mer
20624-20648
0.001
3
6mer
16713-16724
0.001
2
6mer
11675-11686
0.001
3
6mer
26699-26710
0.001
2
6mer
41499-41526
0.001
1
7mer
18394-18419
0.001
1
6mer
18434-18455
0.000
Not Conserved
XLOC_009947
hsa-miR-99b-3p
0.815

Gene Details
Chromosome: chr12
Transcript: TCONS_00020200
Biotype: transcript isomorph
Gene id: XLOC_009947
Gene Name: XLOC_009947
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Brain Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
52-74
0.029
6
7mer
332-357
0.006
2
TSIX
hsa-miR-99b-3p
0.815

Gene Details
Chromosome: X
Transcript: ENST00000604411
Biotype: lincRNA
Gene id: ENSG00000270641
Gene Name: TSIX
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
11517-11540
0.012
Not Conserved
6mer
324-338
0.005
2
7mer
1133-1156
0.003
1
6mer
4436-4450
0.002
2
6mer
14357-14377
0.002
Not Conserved
6mer
10953-10974
0.002
Not Conserved
7mer
11172-11185
0.001
Not Conserved
6mer
19158-19178
0.001
2
6mer
20917-20940
0.001
2
6mer
7311-7335
0.001
1
7mer
14819-14840
0.001
Not Conserved
6mer
11654-11679
0.001
Not Conserved
6mer
9462-9480
0.001
2
6mer
14012-14029
0.001
Not Conserved
6mer
17023-17041
0.001
1
MIR646HG
hsa-miR-99b-3p
0.811

Gene Details
Chromosome: 20
Transcript: ENST00000431181
Biotype: lincRNA
Gene id: ENSG00000228340
Gene Name: MIR646HG
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
357-374
0.025
7
7mer
285-308
0.006
2
6mer
207-226
0.004
2
LINC00507
hsa-miR-99b-3p
0.811

Gene Details
Chromosome: 12
Transcript: ENST00000544645
Biotype: lincRNA
Gene id: ENSG00000256193
Gene Name: LINC00507
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
100-122
0.028
6
7mer
320-345
0.006
2
LINC00507
hsa-miR-99b-3p
0.809

Gene Details
Chromosome: 12
Transcript: NR_046392.1
Biotype: lincRNA
Gene id: NR_046392.1 (gene)
Gene Name: LINC00507
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
62-84
0.029
6
7mer
342-367
0.006
2
AC074391.1
hsa-miR-99b-3p
0.801

Gene Details
Chromosome: 2
Transcript: ENST00000607539
Biotype: lincRNA
Gene id: ENSG00000204929
Gene Name: AC074391.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Lung Normal/Primary
- Testes Normal/Primary


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
83-108
0.026
8
7mer
108-133
0.008
1
LINC00559
hsa-miR-99b-3p
0.798

Gene Details
Chromosome: 13
Transcript: NR_047489.1
Biotype: lincRNA
Gene id: NR_047489.1 (gene)
Gene Name: LINC00559
UCSC graphic: -
Expression: -


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
2514-2533
0.022
1
6mer
960-976
0.003
2
6mer
1170-1195
0.003
2
6mer
1543-1569
0.002
2
6mer
1947-1965
0.002
2
6mer
1415-1437
0.001
1
6mer
2484-2509
0.001
1
FLJ26245
hsa-miR-99b-3p
0.798

Gene Details
Chromosome: 16
Transcript: ENST00000566900
Biotype: lincRNA
Gene id: ENSG00000261122
Gene Name: FLJ26245
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
1110-1126
0.017
1
6mer
1280-1298
0.016
1
LINC00559
hsa-miR-99b-3p
0.798

Gene Details
Chromosome: 13
Transcript: ENST00000569476
Biotype: lincRNA
Gene id: ENSG00000261446
Gene Name: LINC00559
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
2514-2533
0.022
1
6mer
960-976
0.003
2
6mer
1170-1195
0.003
2
6mer
1543-1569
0.002
2
6mer
1947-1965
0.002
2
6mer
1415-1437
0.001
1
6mer
2484-2509
0.001
1
CTD-3222D19.12
hsa-miR-99b-3p
0.797

Gene Details
Chromosome: 19
Transcript: ENST00000595909
Biotype: lincRNA
Gene id: ENSG00000269399
Gene Name: CTD-3222D19.12
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
9mer
163-189
0.022
2
7mer
1915-1933
0.006
2
7mer
1480-1498
0.005
1
XLOC_010798
hsa-miR-99b-3p
0.794

Gene Details
Chromosome: chr14
Transcript: TCONS_00022469
Biotype: transcript isomorph
Gene id: XLOC_010798
Gene Name: XLOC_010798
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Brain Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
- Lung Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
15-39
0.033
12
DNAH17-AS1
hsa-miR-99b-3p
0.792

Gene Details
Chromosome: 17
Transcript: ENST00000588565
Biotype: antisense
Gene id: ENSG00000267432
Gene Name: DNAH17-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HeLa Cervix Cancer/Malignant


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
68-89
0.033
1
XLOC_007141
hsa-miR-99b-3p
0.791

Gene Details
Chromosome: chr8
Transcript: TCONS_00015064
Biotype: transcript isomorph
Gene id: XLOC_007141
Gene Name: XLOC_007141
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Lung Normal/Primary
- Prostate Normal/Primary
- Thyroid Normal/Primary


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
58-84
0.016
2
6mer
16-38
0.016
2
RP11-407B7.1
hsa-miR-99b-3p
0.788

Gene Details
Chromosome: 3
Transcript: ENST00000432154
Biotype: lincRNA
Gene id: ENSG00000230102
Gene Name: RP11-407B7.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
162-181
0.017
1
6mer
2212-2230
0.007
5
6mer
2049-2059
0.004
2
7mer
1658-1675
0.003
2
6mer
1474-1499
0.001
2
6mer
1635-1653
0.001
Not Conserved
XLOC_009652
hsa-miR-99b-3p
0.787

Gene Details
Chromosome: chr12
Transcript: TCONS_00021053
Biotype: transcript isomorph
Gene id: XLOC_009652
Gene Name: XLOC_009652
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
- Brain Normal/Primary
- Breast Normal/Primary
- Colon Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary
Fibroblasts Lung Normal/Primary
- Lung Normal/Primary
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary


miRNA Details
Name: hsa-miR-99b-3p
Sequence: caagcucgugucuguggguccg
MirBase ID: MIMAT0004678
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
100-125
0.018
2
6mer
423-449
0.014
2
Funded by: