Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-99b-5p

ENST00000477144
Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
HOXB-AS3
hsa-miR-99b-5p
0.367

Gene Details
Chromosome: 17
Transcript: ENST00000477144
Biotype: antisense
Gene id: ENSG00000233101
Gene Name: HOXB-AS3
UCSC graphic:
Expression:
  Cell Line Tissue Category
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor


miRNA Details
Name: hsa-miR-99b-5p
Sequence: cacccguagaaccgaccuugcg
MirBase ID: MIMAT0000689
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer+wobble
668-691
0.002
2
Funded by: