Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-99b-5p

ENST00000517300
Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
RP11-661A12.4
hsa-miR-99b-5p
0.404

Gene Details
Chromosome: 8
Transcript: ENST00000517300
Biotype: antisense
Gene id: ENSG00000254144
Gene Name: RP11-661A12.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
hMSC-BM Bone Marrow Stem/Progenitor
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary


miRNA Details
Name: hsa-miR-99b-5p
Sequence: cacccguagaaccgaccuugcg
MirBase ID: MIMAT0000689
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
63-84
0.004
1
Funded by: