Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-99b-5p

ENST00000586064
Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
AC138430.4
hsa-miR-99b-5p
0.404

Gene Details
Chromosome: 19
Transcript: ENST00000586064
Biotype: retained_intron
Gene id: ENSG00000267629
Gene Name: AC138430.4
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-99b-5p
Sequence: cacccguagaaccgaccuugcg
MirBase ID: MIMAT0000689
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
8mer
3520-3541
0.004
2
6mer
4315-4335
0.001
1
Funded by: