Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-99b-5p

ENST00000605233
Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
RP11-734K2.4
hsa-miR-99b-5p
0.374

Gene Details
Chromosome: 12
Transcript: ENST00000605233
Biotype: antisense
Gene id: ENSG00000270344
Gene Name: RP11-734K2.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant


miRNA Details
Name: hsa-miR-99b-5p
Sequence: cacccguagaaccgaccuugcg
MirBase ID: MIMAT0000689
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
1963-1980
0.001
1
6mer
5540-5556
0.001
1
Funded by: