Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-99b-5p

ENST00000623127
Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
CTA-292E10.9
hsa-miR-99b-5p
0.521

Gene Details
Chromosome: 22
Transcript: ENST00000623127
Biotype: antisense
Gene id: ENSG00000280111
Gene Name: CTA-292E10.9
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-99b-5p
Sequence: cacccguagaaccgaccuugcg
MirBase ID: MIMAT0000689
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
2043-2070
0.008
8
7mer
22222-22241
0.003
1
6mer
8389-8400
0.001
1
Funded by: