Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-99b-5p

ENST00000623644
Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
chr22-38_28785274-29006793.1
hsa-miR-99b-5p
0.862

Gene Details
Chromosome: 22
Transcript: ENST00000623644
Biotype: lincRNA
Gene id: ENSG00000279978
Gene Name: chr22-38_28785274-29006793.1
UCSC graphic:
Expression: -


miRNA Details
Name: hsa-miR-99b-5p
Sequence: cacccguagaaccgaccuugcg
MirBase ID: MIMAT0000689
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
7mer
237717-237738
0.004
1
7mer
88563-88579
0.003
1
6mer
227954-227980
0.002
1
6mer
254679-254703
0.002
3
6mer
18950-18970
0.002
1
7mer
22109-22135
0.001
1
6mer
14273-14280
0.001
1
6mer
68832-68843
0.001
1
6mer
64991-65008
0.001
2
6mer
122210-122220
0.001
1
6mer
38267-38284
0.001
1
6mer
211326-211348
0.001
1
6mer
120655-120675
0.001
3
6mer
231628-231644
0.001
1
6mer
181130-181138
0.001
Not Conserved
6mer
180638-180660
0.001
1
6mer
256611-256631
0.001
1
6mer
51503-51522
0.001
2
6mer
242130-242152
0.001
2
6mer
229178-229195
0.001
1
6mer
213300-213317
0.001
1
6mer
102856-102875
0.001
1
6mer
206685-206703
0.001
1
6mer
259858-259874
0.001
Not Conserved
6mer
141512-141538
0.001
3
6mer
11473-11490
0.001
1
6mer
85575-85592
0.001
Not Conserved
6mer
202806-202823
0.001
Not Conserved
7mer
100561-100582
0.001
Not Conserved
6mer
234400-234418
0.001
1
6mer
214419-214444
0.001
1
6mer
74529-74550
0.001
2
6mer
206091-206099
0.001
Not Conserved
6mer
121259-121276
0.001
1
6mer
120201-120222
0.001
3
6mer
51548-51571
0.001
1
6mer
100745-100761
0.000
1
7mer
206131-206148
0.000
Not Conserved
Funded by: