Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
You can download the LncBase v2 Prediction Module data with a 0.6 threshold through this link

hsa-miR-99b-5p

NR_037646.1
Loading... Please wait, this might take a few seconds...



Filters

Gene
miRNA
Score
TMX2-CTNND1
hsa-miR-99b-5p
0.430

Gene Details
Chromosome: 11
Transcript: NR_037646.1
Biotype: sense
Gene id: NR_037646.1 (gene)
Gene Name: TMX2-CTNND1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant
A549 Lung Cancer/Malignant


miRNA Details
Name: hsa-miR-99b-5p
Sequence: cacccguagaaccgaccuugcg
MirBase ID: MIMAT0000689
Related Diseases:

Binding Category
Transcript Position
Binding Score
Conservation
6mer
1243-1260
0.003
9
7mer
2731-2736
0.002
2
6mer
1027-1045
0.001
3
Funded by: