Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-let-7a-2-3p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
MALAT1
hsa-let-7a-2-3p
IP

Gene Details
Chromosome: 11
Transcript: ENST00000534336
Biotype: lincRNA
Gene id: ENSG00000251562
Gene Name: MALAT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-let-7a-2-3p
Sequence: cuguacagccuccuagcuuucc
MirBase ID: MIMAT0010195
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HMSC
Category: Stem/Progenitor
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:65501695-65501723
exon
HITS-CLIP
DIRECT
LncBasev2
NEAT1
hsa-let-7a-2-3p
IP

Gene Details
Chromosome: 11
Transcript: ENST00000501122
Biotype: lincRNA
Gene id: ENSG00000245532
Gene Name: NEAT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-let-7a-2-3p
Sequence: cuguacagccuccuagcuuucc
MirBase ID: MIMAT0010195
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HMSC
Category: Stem/Progenitor
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:65436792-65436836
exon
HITS-CLIP
DIRECT
LncBasev2
11:65427498-65427526
exon
HITS-CLIP
DIRECT
LncBasev2
PSMA6P1
hsa-let-7a-2-3p
-
IP

Gene Details
Chromosome: Y
Transcript: ENST00000400275
Biotype: processed_pseudogene
Gene id: ENSG00000215414
Gene Name: PSMA6P1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-let-7a-2-3p
Sequence: cuguacagccuccuagcuuucc
MirBase ID: MIMAT0010195
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HMSC
Category: Stem/Progenitor
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
Y:13286885-13286913
exon
HITS-CLIP
DIRECT
LncBasev2
RP1-309I22.2
hsa-let-7a-2-3p
IP

Gene Details
Chromosome: 22
Transcript: ENST00000624184
Biotype: sense_overlapping
Gene id: ENSG00000279338
Gene Name: RP1-309I22.2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-let-7a-2-3p
Sequence: cuguacagccuccuagcuuucc
MirBase ID: MIMAT0010195
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HMSC
Category: Stem/Progenitor
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
22:32861883-32861911
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: