Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-let-7b-3p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
AC083843.1
hsa-let-7b-3p
IP

Gene Details
Chromosome: 8
Transcript: ENST00000568248
Biotype: lincRNA
Gene id: ENSG00000259820
Gene Name: AC083843.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-let-7b-3p
Sequence: cuauacaaccuacugccuuccc
MirBase ID: MIMAT0004482
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:134794892-134794920
exon
HITS-CLIP
DIRECT
LncBasev2
CTA-292E10.9
hsa-let-7b-3p
IP

Gene Details
Chromosome: 22
Transcript: ENST00000623127
Biotype: antisense
Gene id: ENSG00000280111
Gene Name: CTA-292E10.9
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-let-7b-3p
Sequence: cuauacaaccuacugccuuccc
MirBase ID: MIMAT0004482
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
22:28786375-28786403
exon
HITS-CLIP
DIRECT
LncBasev2
CTB-89H12.4
hsa-let-7b-3p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000499521
Biotype: retained_intron
Gene id: ENSG00000230551
Gene Name: CTB-89H12.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-let-7b-3p
Sequence: cuauacaaccuacugccuuccc
MirBase ID: MIMAT0004482
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:149494982-149495010
exon
HITS-CLIP
DIRECT
LncBasev2
CTC-444N24.11
hsa-let-7b-3p
IP

Gene Details
Chromosome: 19
Transcript: ENST00000593427
Biotype: lincRNA
Gene id: ENSG00000268205
Gene Name: CTC-444N24.11
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-let-7b-3p
Sequence: cuauacaaccuacugccuuccc
MirBase ID: MIMAT0004482
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:57308319-57308347
exon
HITS-CLIP
DIRECT
LncBasev2
Cervix
HELA
IP
Tested Cell Line: HELA
Category: Cancer/Malignant
Experimental Condition: Hela cells were treated with control shRN.
Location
Region
Method
Result
Validation Type
Source
19:57308041-57308069
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2554C21.1
hsa-let-7b-3p
-
IP

Gene Details
Chromosome: 19
Transcript: ENST00000587765
Biotype: transcribed_processed_pseudogene
Gene id: ENSG00000267422
Gene Name: CTD-2554C21.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant

miRNA Details
Name: hsa-let-7b-3p
Sequence: cuauacaaccuacugccuuccc
MirBase ID: MIMAT0004482
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:37792134-37792162
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2651B20.6
hsa-let-7b-3p
IP

Gene Details
Chromosome: 15
Transcript: ENST00000563103
Biotype: sense_intronic
Gene id: ENSG00000260035
Gene Name: CTD-2651B20.6
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-let-7b-3p
Sequence: cuauacaaccuacugccuuccc
MirBase ID: MIMAT0004482
Related Diseases:

Publication
Tissue
Cell Type
Methods
Bone Marrow
HS27a
IP
Tested Cell Line: HS27a
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
15:45200470-45200498
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2651B20.7
hsa-let-7b-3p
IP

Gene Details
Chromosome: 15
Transcript: ENST00000568314
Biotype: sense_intronic
Gene id: ENSG00000259932
Gene Name: CTD-2651B20.7
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-let-7b-3p
Sequence: cuauacaaccuacugccuuccc
MirBase ID: MIMAT0004482
Related Diseases:

Publication
Tissue
Cell Type
Methods
Bone Marrow
HS27a
IP
Tested Cell Line: HS27a
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
15:45198663-45198691
exon
HITS-CLIP
DIRECT
LncBasev2
EEF1E1-BLOC1S5
hsa-let-7b-3p
IP

Gene Details
Chromosome: 6
Transcript: NR_037618.1
Biotype: sense
Gene id: NR_037618.1 (gene)
Gene Name: EEF1E1-BLOC1S5
UCSC graphic: -
Expression: -

miRNA Details
Name: hsa-let-7b-3p
Sequence: cuauacaaccuacugccuuccc
MirBase ID: MIMAT0004482
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
6:8015209-8015237
exon
HITS-CLIP
DIRECT
LncBasev2
GAS5
hsa-let-7b-3p
-
IP

Gene Details
Chromosome: 1
Transcript: ENST00000421068
Biotype: retained_intron
Gene id: ENSG00000234741
Gene Name: GAS5
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-let-7b-3p
Sequence: cuauacaaccuacugccuuccc
MirBase ID: MIMAT0004482
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:173866349-173866377
exon
HITS-CLIP
DIRECT
LncBasev2
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:173866349-173866377
exon
HITS-CLIP
DIRECT
LncBasev2
Cervix
HELA
IP
Tested Cell Line: HELA
Category: Cancer/Malignant
Experimental Condition: Hela cells were treated with control shRN.
Location
Region
Method
Result
Validation Type
Source
1:173866349-173866377
exon
HITS-CLIP
DIRECT
LncBasev2
HCG11
hsa-let-7b-3p
IP

Gene Details
Chromosome: 6
Transcript: ENST00000411553
Biotype: lincRNA
Gene id: ENSG00000228223
Gene Name: HCG11
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-let-7b-3p
Sequence: cuauacaaccuacugccuuccc
MirBase ID: MIMAT0004482
Related Diseases:

Publication
Tissue
Cell Type
Methods
Cervix
HELA
IP
Tested Cell Line: HELA
Category: Cancer/Malignant
Experimental Condition: Hela cells were treated with control shRN.
Location
Region
Method
Result
Validation Type
Source
6:26524314-26524342
exon
HITS-CLIP
DIRECT
LncBasev2
HOXA10-HOXA9
hsa-let-7b-3p
IP

Gene Details
Chromosome: 7
Transcript: NR_037940.1
Biotype: sense
Gene id: NR_037940.1 (gene)
Gene Name: HOXA10-HOXA9
UCSC graphic: -
Expression: -

miRNA Details
Name: hsa-let-7b-3p
Sequence: cuauacaaccuacugccuuccc
MirBase ID: MIMAT0004482
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:27162979-27163043
exon
HITS-CLIP
DIRECT
LncBasev2
7:27162531-27162559
exon
HITS-CLIP
DIRECT
LncBasev2
HSPA9P1
hsa-let-7b-3p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000432228
Biotype: processed_pseudogene
Gene id: ENSG00000226666
Gene Name: HSPA9P1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-let-7b-3p
Sequence: cuauacaaccuacugccuuccc
MirBase ID: MIMAT0004482
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:221962430-221962458
exon
HITS-CLIP
DIRECT
LncBasev2
LINC00657
hsa-let-7b-3p
IP

Gene Details
Chromosome: 20
Transcript: ENST00000565493
Biotype: lincRNA
Gene id: ENSG00000260032
Gene Name: LINC00657
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-let-7b-3p
Sequence: cuauacaaccuacugccuuccc
MirBase ID: MIMAT0004482
Related Diseases:

Publication
Tissue
Cell Type
Methods
Cervix
HELA
IP
Tested Cell Line: HELA
Category: Cancer/Malignant
Experimental Condition: Hela cells were treated with control shRN.
Location
Region
Method
Result
Validation Type
Source
20:36048916-36048944
exon
HITS-CLIP
DIRECT
LncBasev2
20:36049058-36049086
exon
HITS-CLIP
DIRECT
LncBasev2
20:36048307-36048344
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
20:36048307-36048344
exon
HITS-CLIP
DIRECT
LncBasev2
20:36049058-36049086
exon
HITS-CLIP
DIRECT
LncBasev2
20:36048307-36048344
exon
HITS-CLIP
DIRECT
LncBasev2
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
20:36048307-36048344
exon
HITS-CLIP
DIRECT
LncBasev2
20:36049058-36049086
exon
HITS-CLIP
DIRECT
LncBasev2
MALAT1
hsa-let-7b-3p
IP

Gene Details
Chromosome: 11
Transcript: ENST00000534336
Biotype: lincRNA
Gene id: ENSG00000251562
Gene Name: MALAT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-let-7b-3p
Sequence: cuauacaaccuacugccuuccc
MirBase ID: MIMAT0004482
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:65499912-65499940
exon
HITS-CLIP
DIRECT
LncBasev2
MIR3916
hsa-let-7b-3p
-
IP

Gene Details
Chromosome: 1
Transcript: ENST00000421406
Biotype: transcribed_unprocessed_pseudogene
Gene id: ENSG00000227671
Gene Name: MIR3916
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-let-7b-3p
Sequence: cuauacaaccuacugccuuccc
MirBase ID: MIMAT0004482
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:247200108-247200136
exon
HITS-CLIP
DIRECT
LncBasev2
NEAT1
hsa-let-7b-3p
IP

Gene Details
Chromosome: 11
Transcript: ENST00000501122
Biotype: lincRNA
Gene id: ENSG00000245532
Gene Name: NEAT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-let-7b-3p
Sequence: cuauacaaccuacugccuuccc
MirBase ID: MIMAT0004482
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:65438915-65438943
exon
HITS-CLIP
DIRECT
LncBasev2
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:65445125-65445153
exon
HITS-CLIP
DIRECT
LncBasev2
11:65426515-65426543
exon
HITS-CLIP
DIRECT
LncBasev2
11:65442913-65442941
exon
HITS-CLIP
DIRECT
LncBasev2
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:65437043-65437071
exon
HITS-CLIP
DIRECT
LncBasev2
11:65431877-65431905
exon
HITS-CLIP
DIRECT
LncBasev2
11:65434960-65434988
exon
HITS-CLIP
DIRECT
LncBasev2
11:65430321-65430349
exon
HITS-CLIP
DIRECT
LncBasev2
11:65432864-65432892
exon
HITS-CLIP
DIRECT
LncBasev2
11:65438915-65438943
exon
HITS-CLIP
DIRECT
LncBasev2
NEAT1
hsa-let-7b-3p
-
IP

Gene Details
Chromosome: 11
Transcript: NR_028272.1
Biotype: lincRNA
Gene id: NR_028272.1 (gene)
Gene Name: NEAT1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-let-7b-3p
Sequence: cuauacaaccuacugccuuccc
MirBase ID: MIMAT0004482
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:65426515-65426543
exon
HITS-CLIP
DIRECT
LncBasev2
OIP5-AS1
hsa-let-7b-3p
IP

Gene Details
Chromosome: 15
Transcript: ENST00000500949
Biotype: antisense
Gene id: ENSG00000247556
Gene Name: OIP5-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
HREpiC Kidney Normal/Primary
- Liver Normal/Primary
HepG2 Liver Cancer/Malignant
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
- Lymph Node Normal/Primary
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-let-7b-3p
Sequence: cuauacaaccuacugccuuccc
MirBase ID: MIMAT0004482
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: LCLBAC
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
15:41300508-41300536
exon
PAR-CLIP
DIRECT
LncBasev2
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
15:41300588-41300616
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
15:41300588-41300616
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-174G6.5
hsa-let-7b-3p
IP

Gene Details
Chromosome: 12
Transcript: ENST00000562691
Biotype: sense_overlapping
Gene id: ENSG00000261324
Gene Name: RP11-174G6.5
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-let-7b-3p
Sequence: cuauacaaccuacugccuuccc
MirBase ID: MIMAT0004482
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
12:14762880-14762908
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-227G15.3
hsa-let-7b-3p
IP

Gene Details
Chromosome: 17
Transcript: ENST00000581915
Biotype: processed_transcript
Gene id: ENSG00000265794
Gene Name: RP11-227G15.3
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-let-7b-3p
Sequence: cuauacaaccuacugccuuccc
MirBase ID: MIMAT0004482
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
17:32351853-32351881
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: