Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-let-7b-5p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
AC004593.3
hsa-let-7b-5p
IP

Gene Details
Chromosome: 7
Transcript: ENST00000446246
Biotype: antisense
Gene id: ENSG00000235669
Gene Name: AC004593.3
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-let-7b-5p
Sequence: ugagguaguagguugugugguu
MirBase ID: MIMAT0000063
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
7:29199726-29199754
exon
HITS-CLIP
DIRECT
LncBasev2
AC005154.6
hsa-let-7b-5p
IP

Gene Details
Chromosome: 7
Transcript: ENST00000355837
Biotype: retained_intron
Gene id: ENSG00000196295
Gene Name: AC005154.6
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-let-7b-5p
Sequence: ugagguaguagguugugugguu
MirBase ID: MIMAT0000063
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:30548692-30548720
exon
HITS-CLIP
DIRECT
LncBasev2
AC005789.11
hsa-let-7b-5p
IP

Gene Details
Chromosome: 19
Transcript: ENST00000588453
Biotype: lincRNA
Gene id: ENSG00000267473
Gene Name: AC005789.11
UCSC graphic:
Expression:
  Cell Line Tissue Category
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor

miRNA Details
Name: hsa-let-7b-5p
Sequence: ugagguaguagguugugugguu
MirBase ID: MIMAT0000063
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:38399078-38399106
exon
HITS-CLIP
DIRECT
LncBasev2
AC007246.3
hsa-let-7b-5p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000449569
Biotype: antisense
Gene id: ENSG00000231312
Gene Name: AC007246.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-let-7b-5p
Sequence: ugagguaguagguugugugguu
MirBase ID: MIMAT0000063
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:39600954-39600982
exon
HITS-CLIP
DIRECT
LncBasev2
AC008982.2
hsa-let-7b-5p
-
IP

Gene Details
Chromosome: 19
Transcript: ENST00000600473
Biotype: sense_intronic
Gene id: ENSG00000269688
Gene Name: AC008982.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-let-7b-5p
Sequence: ugagguaguagguugugugguu
MirBase ID: MIMAT0000063
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
19:38845193-38845221
exon
HITS-CLIP
DIRECT
LncBasev2
AC009404.2
hsa-let-7b-5p
IP

Gene Details
Chromosome: 2
Transcript: ENST00000420330
Biotype: lincRNA
Gene id: ENSG00000236255
Gene Name: AC009404.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
- Liver Normal/Primary
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
A549 Lung Cancer/Malignant
- Lymph Node Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-let-7b-5p
Sequence: ugagguaguagguugugugguu
MirBase ID: MIMAT0000063
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: TZMBL
Category: Cancer/Malignant
Experimental Condition: shRNs against HIV-1
Location
Region
Method
Result
Validation Type
Source
2:117839755-117839783
exon
HITS-CLIP
DIRECT
LncBasev2
AC010761.6
hsa-let-7b-5p
-
IP

Gene Details
Chromosome: 17
Transcript: ENST00000584779
Biotype: antisense
Gene id: ENSG00000265073
Gene Name: AC010761.6
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-let-7b-5p
Sequence: ugagguaguagguugugugguu
MirBase ID: MIMAT0000063
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
17:28742494-28742522
exon
HITS-CLIP
DIRECT
LncBasev2
AC063979.1
hsa-let-7b-5p
-
IP

Gene Details
Chromosome: 5
Transcript: ENST00000415539
Biotype: unitary_pseudogene
Gene id: ENSG00000223497
Gene Name: AC063979.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-let-7b-5p
Sequence: ugagguaguagguugugugguu
MirBase ID: MIMAT0000063
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HEK293
Category: Embryonic/Fetal
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:72733991-72734019
exon
PAR-CLIP
DIRECT
LncBasev2
AC074117.10
hsa-let-7b-5p
IP

Gene Details
Chromosome: 2
Transcript: ENST00000447070
Biotype: antisense
Gene id: ENSG00000234072
Gene Name: AC074117.10
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-let-7b-5p
Sequence: ugagguaguagguugugugguu
MirBase ID: MIMAT0000063
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:27358701-27358771
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:27358701-27358771
exon
HITS-CLIP
DIRECT
LncBasev2
2:27358707-27358771
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: TZMBL
Category: Cancer/Malignant
Experimental Condition: shRNs against HIV-1
Location
Region
Method
Result
Validation Type
Source
2:27358721-27358771
exon
HITS-CLIP
DIRECT
LncBasev2
AC084082.3
hsa-let-7b-5p
IP

Gene Details
Chromosome: 8
Transcript: ENST00000517961
Biotype: lincRNA
Gene id: ENSG00000253190
Gene Name: AC084082.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-let-7b-5p
Sequence: ugagguaguagguugugugguu
MirBase ID: MIMAT0000063
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:66113386-66113414
exon
HITS-CLIP
DIRECT
LncBasev2
8:66113386-66113414
exon
HITS-CLIP
DIRECT
LncBasev2
AC090602.2
hsa-let-7b-5p
-
IP

Gene Details
Chromosome: 15
Transcript: ENST00000469695
Biotype: processed_pseudogene
Gene id: ENSG00000242088
Gene Name: AC090602.2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-let-7b-5p
Sequence: ugagguaguagguugugugguu
MirBase ID: MIMAT0000063
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
15:24911029-24911057
exon
HITS-CLIP
DIRECT
LncBasev2
AC091729.9
hsa-let-7b-5p
IP

Gene Details
Chromosome: 7
Transcript: NR_110070.1
Biotype: lincRNA
Gene id: NR_110070.1 (gene)
Gene Name: AC091729.9
UCSC graphic: -
Expression:
  Cell Line Tissue Category
HUVEC Blood Vessel Normal/Primary
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-let-7b-5p
Sequence: ugagguaguagguugugugguu
MirBase ID: MIMAT0000063
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: BC3
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:1165347-1165375
exon
PAR-CLIP
DIRECT
LncBasev2
Tested Cell Line: TZMBL
Category: Cancer/Malignant
Experimental Condition: shRNs against HIV-1
Location
Region
Method
Result
Validation Type
Source
7:1165347-1165375
exon
HITS-CLIP
DIRECT
LncBasev2
AC091729.9
hsa-let-7b-5p
IP

Gene Details
Chromosome: 7
Transcript: NR_110065.1
Biotype: antisense
Gene id: NR_110065.1 (gene)
Gene Name: AC091729.9
UCSC graphic: -
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant

miRNA Details
Name: hsa-let-7b-5p
Sequence: ugagguaguagguugugugguu
MirBase ID: MIMAT0000063
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: TZMBL
Category: Cancer/Malignant
Experimental Condition: shRNs against HIV-1
Location
Region
Method
Result
Validation Type
Source
7:1165347-1165375
exon
HITS-CLIP
DIRECT
LncBasev2
Tested Cell Line: BC3
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:1165347-1165375
exon
PAR-CLIP
DIRECT
LncBasev2
AC093724.2
hsa-let-7b-5p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000448659
Biotype: processed_pseudogene
Gene id: ENSG00000213222
Gene Name: AC093724.2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-let-7b-5p
Sequence: ugagguaguagguugugugguu
MirBase ID: MIMAT0000063
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:131723613-131723641
exon
HITS-CLIP
DIRECT
LncBasev2
AC093838.4
hsa-let-7b-5p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000438378
Biotype: processed_transcript
Gene id: ENSG00000152117
Gene Name: AC093838.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-let-7b-5p
Sequence: ugagguaguagguugugugguu
MirBase ID: MIMAT0000063
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:131516326-131516354
exon
HITS-CLIP
DIRECT
LncBasev2
AC116366.6
hsa-let-7b-5p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000443093
Biotype: antisense
Gene id: ENSG00000234290
Gene Name: AC116366.6
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-let-7b-5p
Sequence: ugagguaguagguugugugguu
MirBase ID: MIMAT0000063
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:132471267-132471295
exon
HITS-CLIP
DIRECT
LncBasev2
AC124997.1
hsa-let-7b-5p
IP

Gene Details
Chromosome: 15
Transcript: ENST00000422117
Biotype: lincRNA
Gene id: ENSG00000235731
Gene Name: AC124997.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adrenal Normal/Primary
- Brain Normal/Primary
- Heart Normal/Primary
- Liver Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary

miRNA Details
Name: hsa-let-7b-5p
Sequence: ugagguaguagguugugugguu
MirBase ID: MIMAT0000063
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
15:25501174-25501202
exon
HITS-CLIP
DIRECT
LncBasev2
AC135048.13
hsa-let-7b-5p
IP

Gene Details
Chromosome: 16
Transcript: ENST00000566056
Biotype: processed_transcript
Gene id: ENSG00000261487
Gene Name: AC135048.13
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-let-7b-5p
Sequence: ugagguaguagguugugugguu
MirBase ID: MIMAT0000063
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
16:30948539-30948567
exon
HITS-CLIP
DIRECT
LncBasev2
ACTBP2
hsa-let-7b-5p
-
IP

Gene Details
Chromosome: 5
Transcript: ENST00000515712
Biotype: processed_pseudogene
Gene id: ENSG00000213763
Gene Name: ACTBP2
UCSC graphic:
Expression:
  Cell Line Tissue Category
IMR90 Lung Embryonic/Fetal/Stem/Progenitor

miRNA Details
Name: hsa-let-7b-5p
Sequence: ugagguaguagguugugugguu
MirBase ID: MIMAT0000063
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:77785422-77785450
exon
HITS-CLIP
DIRECT
LncBasev2
ACTBP7
hsa-let-7b-5p
-
IP

Gene Details
Chromosome: 15
Transcript: ENST00000418351
Biotype: processed_pseudogene
Gene id: ENSG00000185607
Gene Name: ACTBP7
UCSC graphic:
Expression:
  Cell Line Tissue Category
HUVEC Blood Vessel Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor

miRNA Details
Name: hsa-let-7b-5p
Sequence: ugagguaguagguugugugguu
MirBase ID: MIMAT0000063
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: -
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
15:43989616-43989644
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: