Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-let-7e-3p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
CTC-308K20.3
hsa-let-7e-3p
-
IP

Gene Details
Chromosome: 5
Transcript: ENST00000523057
Biotype: processed_pseudogene
Gene id: ENSG00000253785
Gene Name: CTC-308K20.3
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-let-7e-3p
Sequence: cuauacggccuccuagcuuucc
MirBase ID: MIMAT0004485
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:172975745-172975773
exon
HITS-CLIP
DIRECT
LncBasev2
CTC-444N24.11
hsa-let-7e-3p
IP

Gene Details
Chromosome: 19
Transcript: ENST00000593427
Biotype: lincRNA
Gene id: ENSG00000268205
Gene Name: CTC-444N24.11
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-let-7e-3p
Sequence: cuauacggccuccuagcuuucc
MirBase ID: MIMAT0004485
Related Diseases:

Publication
Tissue
Cell Type
Methods
Cervix
HELA
IP
Tested Cell Line: HELA
Category: Cancer/Malignant
Experimental Condition: Hela cells were treated with control shRN.
Location
Region
Method
Result
Validation Type
Source
19:57308041-57308069
exon
HITS-CLIP
DIRECT
LncBasev2
LINC00657
hsa-let-7e-3p
IP

Gene Details
Chromosome: 20
Transcript: ENST00000565493
Biotype: lincRNA
Gene id: ENSG00000260032
Gene Name: LINC00657
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-let-7e-3p
Sequence: cuauacggccuccuagcuuucc
MirBase ID: MIMAT0004485
Related Diseases:

Publication
Tissue
Cell Type
Methods
Cervix
HELA
IP
Tested Cell Line: HELA
Category: Cancer/Malignant
Experimental Condition: Hela cells were treated with control shRN.
Location
Region
Method
Result
Validation Type
Source
20:36049058-36049086
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-174G6.5
hsa-let-7e-3p
IP

Gene Details
Chromosome: 12
Transcript: ENST00000562691
Biotype: sense_overlapping
Gene id: ENSG00000261324
Gene Name: RP11-174G6.5
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-let-7e-3p
Sequence: cuauacggccuccuagcuuucc
MirBase ID: MIMAT0004485
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
12:14762880-14762908
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-750B16.1
hsa-let-7e-3p
-
IP

Gene Details
Chromosome: 17
Transcript: ENST00000574371
Biotype: processed_pseudogene
Gene id: ENSG00000262902
Gene Name: RP11-750B16.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-let-7e-3p
Sequence: cuauacggccuccuagcuuucc
MirBase ID: MIMAT0004485
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
17:53106320-53106348
exon
HITS-CLIP
DIRECT
LncBasev2
Cervix
HELA
IP
Tested Cell Line: HELA
Category: Cancer/Malignant
Experimental Condition: Hela cells were treated with control shRNA.
Location
Region
Method
Result
Validation Type
Source
17:53106320-53106348
exon
HITS-CLIP
DIRECT
LncBasev2
RP3-400B16.1
hsa-let-7e-3p
IP

Gene Details
Chromosome: 6
Transcript: ENST00000427049
Biotype: lincRNA
Gene id: ENSG00000234817
Gene Name: RP3-400B16.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-let-7e-3p
Sequence: cuauacggccuccuagcuuucc
MirBase ID: MIMAT0004485
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
6:4156388-4156416
exon
HITS-CLIP
DIRECT
LncBasev2
RPL5P18
hsa-let-7e-3p
-
IP

Gene Details
Chromosome: 6
Transcript: ENST00000406671
Biotype: processed_pseudogene
Gene id: ENSG00000220744
Gene Name: RPL5P18
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant

miRNA Details
Name: hsa-let-7e-3p
Sequence: cuauacggccuccuagcuuucc
MirBase ID: MIMAT0004485
Related Diseases:

Publication
Tissue
Cell Type
Methods
Cervix
HELA
IP
Tested Cell Line: HELA
Category: Cancer/Malignant
Experimental Condition: Hela cells were treated with control shRNA.
Location
Region
Method
Result
Validation Type
Source
6:127362692-127362720
exon
HITS-CLIP
DIRECT
LncBasev2
RPL5P34
hsa-let-7e-3p
-
IP

Gene Details
Chromosome: 22
Transcript: ENST00000426545
Biotype: processed_pseudogene
Gene id: ENSG00000234009
Gene Name: RPL5P34
UCSC graphic:
Expression:
  Cell Line Tissue Category
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-let-7e-3p
Sequence: cuauacggccuccuagcuuucc
MirBase ID: MIMAT0004485
Related Diseases:

Publication
Tissue
Cell Type
Methods
Cervix
HELA
IP
Tested Cell Line: HELA
Category: Cancer/Malignant
Experimental Condition: Hela cells were treated with control shRNA.
Location
Region
Method
Result
Validation Type
Source
22:42777089-42777117
exon
HITS-CLIP
DIRECT
LncBasev2
XLOC_003181
hsa-let-7e-3p
IP

Gene Details
Chromosome: chr3
Transcript: TCONS_00007196
Biotype: transcript isomorph
Gene id: XLOC_003181
Gene Name: XLOC_003181
UCSC graphic: -
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
- Brain Normal/Primary
SK-N-SH Brain Cancer/Malignant
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
- Kidney Normal/Primary
- Liver Normal/Primary
HepG2 Liver Cancer/Malignant
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
- Lymph Node Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-let-7e-3p
Sequence: cuauacggccuccuagcuuucc
MirBase ID: MIMAT0004485
Related Diseases:

Publication
Tissue
Cell Type
Methods
Cervix
HELA
IP
Tested Cell Line: HELA
Category: Cancer/Malignant
Experimental Condition: Hela cells were treated with control shRN.
Location
Region
Method
Result
Validation Type
Source
chr3:96618159-96618187
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: