Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-147a

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
DYNC1I2P1
hsa-miR-147a
-
IP

Gene Details
Chromosome: 10
Transcript: ENST00000435916
Biotype: processed_pseudogene
Gene id: ENSG00000225137
Gene Name: DYNC1I2P1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-147a
Sequence: guguguggaaaugcuucugc
MirBase ID: MIMAT0000251
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
10:50266012-50266044
exon
HITS-CLIP
DIRECT
LncBasev2
GS1-358P8.4
hsa-miR-147a
IP

Gene Details
Chromosome: X
Transcript: ENST00000568479
Biotype: sense_overlapping
Gene id: ENSG00000260822
Gene Name: GS1-358P8.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-147a
Sequence: guguguggaaaugcuucugc
MirBase ID: MIMAT0000251
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
X:24550116-24550146
exon
HITS-CLIP
DIRECT
LncBasev2
HCG18
hsa-miR-147a
IP

Gene Details
Chromosome: 6
Transcript: ENST00000426882
Biotype: antisense
Gene id: ENSG00000231074
Gene Name: HCG18
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-147a
Sequence: guguguggaaaugcuucugc
MirBase ID: MIMAT0000251
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
6:30326895-30326925
exon
HITS-CLIP
DIRECT
LncBasev2
MALAT1
hsa-miR-147a
IP

Gene Details
Chromosome: 11
Transcript: ENST00000534336
Biotype: lincRNA
Gene id: ENSG00000251562
Gene Name: MALAT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-147a
Sequence: guguguggaaaugcuucugc
MirBase ID: MIMAT0000251
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:65504810-65504838
exon
HITS-CLIP
DIRECT
LncBasev2
NEAT1
hsa-miR-147a
IP

Gene Details
Chromosome: 11
Transcript: ENST00000501122
Biotype: lincRNA
Gene id: ENSG00000245532
Gene Name: NEAT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-147a
Sequence: guguguggaaaugcuucugc
MirBase ID: MIMAT0000251
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:65431354-65431384
exon
HITS-CLIP
DIRECT
LncBasev2
11:65443323-65443363
exon
HITS-CLIP
DIRECT
LncBasev2
11:65443870-65443898
exon
HITS-CLIP
DIRECT
LncBasev2
11:65445129-65445159
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-90H3.1
hsa-miR-147a
-
IP

Gene Details
Chromosome: 1
Transcript: ENST00000415279
Biotype: processed_pseudogene
Gene id: ENSG00000232952
Gene Name: RP11-90H3.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-147a
Sequence: guguguggaaaugcuucugc
MirBase ID: MIMAT0000251
Related Diseases:

Publication
Tissue
Cell Type
Methods
Bone Marrow
HS27a
IP
Tested Cell Line: HS27a
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:105892732-105892762
exon
HITS-CLIP
DIRECT
LncBasev2
1:105892732-105892762
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-9L18.2
hsa-miR-147a
-
IP

Gene Details
Chromosome: 1
Transcript: ENST00000400979
Biotype: processed_pseudogene
Gene id: ENSG00000215835
Gene Name: RP11-9L18.2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-147a
Sequence: guguguggaaaugcuucugc
MirBase ID: MIMAT0000251
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:166277001-166277029
exon
HITS-CLIP
DIRECT
LncBasev2
RP5-1014D13.2
hsa-miR-147a
IP

Gene Details
Chromosome: 22
Transcript: ENST00000623726
Biotype: sense_overlapping
Gene id: ENSG00000279738
Gene Name: RP5-1014D13.2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-147a
Sequence: guguguggaaaugcuucugc
MirBase ID: MIMAT0000251
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
22:37888450-37888480
exon
HITS-CLIP
DIRECT
LncBasev2
ZFP91-CNTF
hsa-miR-147a
IP

Gene Details
Chromosome: 11
Transcript: NR_024091.1
Biotype: sense
Gene id: NR_024091.1 (gene)
Gene Name: ZFP91-CNTF
UCSC graphic: -
Expression: -

miRNA Details
Name: hsa-miR-147a
Sequence: guguguggaaaugcuucugc
MirBase ID: MIMAT0000251
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: HS5
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:58617311-58617339
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: