Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-1915-3p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
AC012309.5
hsa-miR-1915-3p
IP

Gene Details
Chromosome: 19
Transcript: ENST00000592712
Biotype: lincRNA
Gene id: ENSG00000226686
Gene Name: AC012309.5
UCSC graphic:
Expression:
  Cell Line Tissue Category
SK-N-SH Brain Cancer/Malignant

miRNA Details
Name: hsa-miR-1915-3p
Sequence: ccccagggcgacgcggcggg
MirBase ID: MIMAT0007892
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:37259020-37259048
exon
HITS-CLIP
DIRECT
LncBasev2
CASC7
hsa-miR-1915-3p
IP

Gene Details
Chromosome: 8
Transcript: ENST00000560295
Biotype: lincRNA
Gene id: ENSG00000259758
Gene Name: CASC7
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-1915-3p
Sequence: ccccagggcgacgcggcggg
MirBase ID: MIMAT0007892
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:140524106-140524134
exon
HITS-CLIP
DIRECT
LncBasev2
8:140529182-140529210
exon
HITS-CLIP
DIRECT
LncBasev2
CD24P4
hsa-miR-1915-3p
-
IP

Gene Details
Chromosome: Y
Transcript: ENST00000382840
Biotype: processed_pseudogene
Gene id: ENSG00000185275
Gene Name: CD24P4
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-1915-3p
Sequence: ccccagggcgacgcggcggg
MirBase ID: MIMAT0007892
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
Y:18992674-18992702
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2554C21.1
hsa-miR-1915-3p
-
IP

Gene Details
Chromosome: 19
Transcript: ENST00000587765
Biotype: transcribed_processed_pseudogene
Gene id: ENSG00000267422
Gene Name: CTD-2554C21.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant

miRNA Details
Name: hsa-miR-1915-3p
Sequence: ccccagggcgacgcggcggg
MirBase ID: MIMAT0007892
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:37792319-37792347
exon
HITS-CLIP
DIRECT
LncBasev2
EIF3FP3
hsa-miR-1915-3p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000434851
Biotype: processed_pseudogene
Gene id: ENSG00000233426
Gene Name: EIF3FP3
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-1915-3p
Sequence: ccccagggcgacgcggcggg
MirBase ID: MIMAT0007892
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:58252099-58252127
exon
HITS-CLIP
DIRECT
LncBasev2
FAM83H-AS1
hsa-miR-1915-3p
IP

Gene Details
Chromosome: 8
Transcript: ENST00000534398
Biotype: lincRNA
Gene id: ENSG00000203499
Gene Name: FAM83H-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-1915-3p
Sequence: ccccagggcgacgcggcggg
MirBase ID: MIMAT0007892
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:143741973-143742001
exon
HITS-CLIP
DIRECT
LncBasev2
GAS5
hsa-miR-1915-3p
IP

Gene Details
Chromosome: 1
Transcript: ENST00000421068
Biotype: retained_intron
Gene id: ENSG00000234741
Gene Name: GAS5
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-1915-3p
Sequence: ccccagggcgacgcggcggg
MirBase ID: MIMAT0007892
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:173866297-173866325
exon
HITS-CLIP
DIRECT
LncBasev2
GJA9-MYCBP
hsa-miR-1915-3p
-
IP

Gene Details
Chromosome: 1
Transcript: NR_037633.1
Biotype: sense
Gene id: NR_037633.1 (gene)
Gene Name: GJA9-MYCBP
UCSC graphic: -
Expression: -

miRNA Details
Name: hsa-miR-1915-3p
Sequence: ccccagggcgacgcggcggg
MirBase ID: MIMAT0007892
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
1:38863643-38863671
exon
HITS-CLIP
DIRECT
LncBasev2
LINC00116
hsa-miR-1915-3p
IP

Gene Details
Chromosome: 2
Transcript: NR_027063.1
Biotype: sense
Gene id: NR_027063.1 (gene)
Gene Name: LINC00116
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-1915-3p
Sequence: ccccagggcgacgcggcggg
MirBase ID: MIMAT0007892
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:110212454-110212482
exon
HITS-CLIP
DIRECT
LncBasev2
LINC00665
hsa-miR-1915-3p
IP

Gene Details
Chromosome: 19
Transcript: ENST00000438368
Biotype: lincRNA
Gene id: ENSG00000232677
Gene Name: LINC00665
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
HMEpC Mammary Gland Normal/Primary
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-1915-3p
Sequence: ccccagggcgacgcggcggg
MirBase ID: MIMAT0007892
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:36320304-36320332
exon
HITS-CLIP
DIRECT
LncBasev2
NEAT1
hsa-miR-1915-3p
IP

Gene Details
Chromosome: 11
Transcript: ENST00000501122
Biotype: lincRNA
Gene id: ENSG00000245532
Gene Name: NEAT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-1915-3p
Sequence: ccccagggcgacgcggcggg
MirBase ID: MIMAT0007892
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:65442462-65442490
exon
HITS-CLIP
DIRECT
LncBasev2
11:65433894-65433922
exon
HITS-CLIP
DIRECT
LncBasev2
11:65434070-65434098
exon
HITS-CLIP
DIRECT
LncBasev2
11:65441257-65441285
exon
HITS-CLIP
DIRECT
LncBasev2
11:65443159-65443187
exon
HITS-CLIP
DIRECT
LncBasev2
11:65427525-65427553
exon
HITS-CLIP
DIRECT
LncBasev2
11:65427312-65427340
exon
HITS-CLIP
DIRECT
LncBasev2
11:65422896-65422924
exon
HITS-CLIP
DIRECT
LncBasev2
11:65444647-65444675
exon
HITS-CLIP
DIRECT
LncBasev2
11:65430244-65430272
exon
HITS-CLIP
DIRECT
LncBasev2
11:65435714-65435742
exon
HITS-CLIP
DIRECT
LncBasev2
11:65428004-65428032
exon
HITS-CLIP
DIRECT
LncBasev2
11:65427138-65427166
exon
HITS-CLIP
DIRECT
LncBasev2
11:65444699-65444735
exon
HITS-CLIP
DIRECT
LncBasev2
11:65441954-65441982
exon
HITS-CLIP
DIRECT
LncBasev2
11:65434670-65434698
exon
HITS-CLIP
DIRECT
LncBasev2
11:65423292-65423320
exon
HITS-CLIP
DIRECT
LncBasev2
11:65438154-65438182
exon
HITS-CLIP
DIRECT
LncBasev2
NEAT1
hsa-miR-1915-3p
IP

Gene Details
Chromosome: 11
Transcript: NR_028272.1
Biotype: lincRNA
Gene id: NR_028272.1 (gene)
Gene Name: NEAT1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-1915-3p
Sequence: ccccagggcgacgcggcggg
MirBase ID: MIMAT0007892
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
11:65422896-65422924
exon
HITS-CLIP
DIRECT
LncBasev2
11:65423292-65423320
exon
HITS-CLIP
DIRECT
LncBasev2
RAB4B-EGLN2
hsa-miR-1915-3p
IP

Gene Details
Chromosome: 19
Transcript: NR_037791.1
Biotype: sense
Gene id: NR_037791.1 (gene)
Gene Name: RAB4B-EGLN2
UCSC graphic: -
Expression: -

miRNA Details
Name: hsa-miR-1915-3p
Sequence: ccccagggcgacgcggcggg
MirBase ID: MIMAT0007892
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:40807894-40807922
exon
HITS-CLIP
DIRECT
LncBasev2
RNASEK-C17orf49
hsa-miR-1915-3p
IP

Gene Details
Chromosome: 17
Transcript: NR_037717.1
Biotype: sense
Gene id: NR_037717.1 (gene)
Gene Name: RNASEK-C17orf49
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HREpiC Kidney Normal/Primary

miRNA Details
Name: hsa-miR-1915-3p
Sequence: ccccagggcgacgcggcggg
MirBase ID: MIMAT0007892
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
17:7014439-7014467
exon
HITS-CLIP
DIRECT
LncBasev2
RNF216P1
hsa-miR-1915-3p
-
IP

Gene Details
Chromosome: 7
Transcript: ENST00000471244
Biotype: processed_transcript
Gene id: ENSG00000196204
Gene Name: RNF216P1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-1915-3p
Sequence: ccccagggcgacgcggcggg
MirBase ID: MIMAT0007892
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
7:4996795-4996849
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-142E9.1
hsa-miR-1915-3p
IP

Gene Details
Chromosome: 13
Transcript: ENST00000621575
Biotype: sense_intronic
Gene id: ENSG00000276672
Gene Name: RP11-142E9.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-1915-3p
Sequence: ccccagggcgacgcggcggg
MirBase ID: MIMAT0007892
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
13:33847986-33848014
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-203J24.9
hsa-miR-1915-3p
IP

Gene Details
Chromosome: 9
Transcript: ENST00000548587
Biotype: processed_transcript
Gene id: ENSG00000257524
Gene Name: RP11-203J24.9
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-1915-3p
Sequence: ccccagggcgacgcggcggg
MirBase ID: MIMAT0007892
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
9:127885398-127885426
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-314C16.1
hsa-miR-1915-3p
IP

Gene Details
Chromosome: 6
Transcript: NR_038979.1
Biotype: lincRNA
Gene id: NR_038979.1 (gene)
Gene Name: RP11-314C16.1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor

miRNA Details
Name: hsa-miR-1915-3p
Sequence: ccccagggcgacgcggcggg
MirBase ID: MIMAT0007892
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
6:8438023-8438051
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-475C16.1
hsa-miR-1915-3p
-
IP

Gene Details
Chromosome: 6
Transcript: ENST00000492974
Biotype: processed_pseudogene
Gene id: ENSG00000218426
Gene Name: RP11-475C16.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-1915-3p
Sequence: ccccagggcgacgcggcggg
MirBase ID: MIMAT0007892
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
6:153282445-153282473
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-489N22.3
hsa-miR-1915-3p
IP

Gene Details
Chromosome: 9
Transcript: ENST00000602859
Biotype: lincRNA
Gene id: ENSG00000269909
Gene Name: RP11-489N22.3
UCSC graphic:
Expression:
  Cell Line Tissue Category
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-1915-3p
Sequence: ccccagggcgacgcggcggg
MirBase ID: MIMAT0007892
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
9:126700629-126700664
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: