Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-1915-5p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
AC083939.1
hsa-miR-1915-5p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000445475
Biotype: processed_pseudogene
Gene id: ENSG00000229013
Gene Name: AC083939.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-1915-5p
Sequence: accuugccuugcugcccgggcc
MirBase ID: MIMAT0007891
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
2:35471767-35471795
exon
HITS-CLIP
DIRECT
LncBasev2
chr22-38_28785274-29006793.1
hsa-miR-1915-5p
IP

Gene Details
Chromosome: 22
Transcript: ENST00000623644
Biotype: lincRNA
Gene id: ENSG00000279978
Gene Name: chr22-38_28785274-29006793.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-1915-5p
Sequence: accuugccuugcugcccgggcc
MirBase ID: MIMAT0007891
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
22:29134058-29134086
exon
HITS-CLIP
DIRECT
LncBasev2
CTC-273B12.8
hsa-miR-1915-5p
IP

Gene Details
Chromosome: 19
Transcript: ENST00000427476
Biotype: lincRNA
Gene id: ENSG00000269751
Gene Name: CTC-273B12.8
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-1915-5p
Sequence: accuugccuugcugcccgggcc
MirBase ID: MIMAT0007891
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
19:48479843-48479871
exon
HITS-CLIP
DIRECT
LncBasev2
19:48481014-48481042
exon
HITS-CLIP
DIRECT
LncBasev2
19:48479843-48479871
exon
HITS-CLIP
DIRECT
LncBasev2
CTC-325H20.2
hsa-miR-1915-5p
IP

Gene Details
Chromosome: 19
Transcript: ENST00000592371
Biotype: lincRNA
Gene id: ENSG00000266912
Gene Name: CTC-325H20.2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-1915-5p
Sequence: accuugccuugcugcccgggcc
MirBase ID: MIMAT0007891
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
19:9345169-9345197
exon
HITS-CLIP
DIRECT
LncBasev2
GS1-124K5.11
hsa-miR-1915-5p
IP

Gene Details
Chromosome: 7
Transcript: ENST00000449307
Biotype: lincRNA
Gene id: ENSG00000229180
Gene Name: GS1-124K5.11
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor

miRNA Details
Name: hsa-miR-1915-5p
Sequence: accuugccuugcugcccgggcc
MirBase ID: MIMAT0007891
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
7:66541493-66541521
exon
HITS-CLIP
DIRECT
LncBasev2
HNRNPA1P4
hsa-miR-1915-5p
-
IP

Gene Details
Chromosome: 8
Transcript: ENST00000509706
Biotype: processed_pseudogene
Gene id: ENSG00000206228
Gene Name: HNRNPA1P4
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-1915-5p
Sequence: accuugccuugcugcccgggcc
MirBase ID: MIMAT0007891
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
8:82292361-82292389
exon
HITS-CLIP
DIRECT
LncBasev2
HNRNPUL2-BSCL2
hsa-miR-1915-5p
IP

Gene Details
Chromosome: 11
Transcript: NR_037946.1
Biotype: sense
Gene id: NR_037946.1 (gene)
Gene Name: HNRNPUL2-BSCL2
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-1915-5p
Sequence: accuugccuugcugcccgggcc
MirBase ID: MIMAT0007891
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
11:62727077-62727105
exon
HITS-CLIP
DIRECT
LncBasev2
11:62726981-62727009
exon
HITS-CLIP
DIRECT
LncBasev2
KCNQ1OT1
hsa-miR-1915-5p
IP

Gene Details
Chromosome: 11
Transcript: ENST00000597346
Biotype: antisense
Gene id: ENSG00000269821
Gene Name: KCNQ1OT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HepG2 Liver Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-1915-5p
Sequence: accuugccuugcugcccgggcc
MirBase ID: MIMAT0007891
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
11:2646103-2646131
exon
HITS-CLIP
DIRECT
LncBasev2
11:2664287-2664315
exon
HITS-CLIP
DIRECT
LncBasev2
LOC100507472
hsa-miR-1915-5p
IP

Gene Details
Chromosome: 15
Transcript: NR_045387.1
Biotype: sense
Gene id: NR_045387.1 (gene)
Gene Name: LOC100507472
UCSC graphic: -
Expression: -

miRNA Details
Name: hsa-miR-1915-5p
Sequence: accuugccuugcugcccgggcc
MirBase ID: MIMAT0007891
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
15:101308752-101308780
exon
HITS-CLIP
DIRECT
LncBasev2
MALAT1
hsa-miR-1915-5p
IP

Gene Details
Chromosome: 11
Transcript: ENST00000534336
Biotype: lincRNA
Gene id: ENSG00000251562
Gene Name: MALAT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-1915-5p
Sequence: accuugccuugcugcccgggcc
MirBase ID: MIMAT0007891
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
11:65502084-65502112
exon
HITS-CLIP
DIRECT
LncBasev2
11:65504034-65504062
exon
HITS-CLIP
DIRECT
LncBasev2
11:65505636-65505664
exon
HITS-CLIP
DIRECT
LncBasev2
11:65505504-65505532
exon
HITS-CLIP
DIRECT
LncBasev2
11:65502922-65502950
exon
HITS-CLIP
DIRECT
LncBasev2
11:65502922-65502950
exon
HITS-CLIP
DIRECT
LncBasev2
11:65505504-65505532
exon
HITS-CLIP
DIRECT
LncBasev2
11:65505636-65505664
exon
HITS-CLIP
DIRECT
LncBasev2
11:65502922-65502950
exon
HITS-CLIP
DIRECT
LncBasev2
11:65501285-65501313
exon
HITS-CLIP
DIRECT
LncBasev2
11:65505504-65505532
exon
HITS-CLIP
DIRECT
LncBasev2
11:65504034-65504062
exon
HITS-CLIP
DIRECT
LncBasev2
11:65502084-65502112
exon
HITS-CLIP
DIRECT
LncBasev2
11:65501285-65501313
exon
HITS-CLIP
DIRECT
LncBasev2
11:65505504-65505532
exon
HITS-CLIP
DIRECT
LncBasev2
11:65505504-65505532
exon
HITS-CLIP
DIRECT
LncBasev2
11:65501285-65501313
exon
HITS-CLIP
DIRECT
LncBasev2
11:65504034-65504062
exon
HITS-CLIP
DIRECT
LncBasev2
MIR10A
hsa-miR-1915-5p
IP

Gene Details
Chromosome: 17
Transcript: ENST00000548801
Biotype: sense_intronic
Gene id: ENSG00000257178
Gene Name: MIR10A
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant

miRNA Details
Name: hsa-miR-1915-5p
Sequence: accuugccuugcugcccgggcc
MirBase ID: MIMAT0007891
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
17:48581160-48581188
exon
HITS-CLIP
DIRECT
LncBasev2
NACAP1
hsa-miR-1915-5p
-
IP

Gene Details
Chromosome: 8
Transcript: ENST00000419462
Biotype: processed_transcript
Gene id: ENSG00000228224
Gene Name: NACAP1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-1915-5p
Sequence: accuugccuugcugcccgggcc
MirBase ID: MIMAT0007891
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
8:101369119-101369147
exon
HITS-CLIP
DIRECT
LncBasev2
NEAT1
hsa-miR-1915-5p
IP

Gene Details
Chromosome: 11
Transcript: ENST00000501122
Biotype: lincRNA
Gene id: ENSG00000245532
Gene Name: NEAT1
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD1 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-1915-5p
Sequence: accuugccuugcugcccgggcc
MirBase ID: MIMAT0007891
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
11:65425317-65425345
exon
HITS-CLIP
DIRECT
LncBasev2
11:65437930-65437958
exon
HITS-CLIP
DIRECT
LncBasev2
11:65436282-65436310
exon
HITS-CLIP
DIRECT
LncBasev2
11:65422921-65422949
exon
HITS-CLIP
DIRECT
LncBasev2
11:65425317-65425345
exon
HITS-CLIP
DIRECT
LncBasev2
11:65439385-65439413
exon
HITS-CLIP
DIRECT
LncBasev2
11:65425215-65425243
exon
HITS-CLIP
DIRECT
LncBasev2
11:65440539-65440567
exon
HITS-CLIP
DIRECT
LncBasev2
11:65440539-65440567
exon
HITS-CLIP
DIRECT
LncBasev2
11:65425317-65425345
exon
HITS-CLIP
DIRECT
LncBasev2
11:65425317-65425345
exon
HITS-CLIP
DIRECT
LncBasev2
11:65422921-65422949
exon
HITS-CLIP
DIRECT
LncBasev2
11:65444850-65444878
exon
HITS-CLIP
DIRECT
LncBasev2
11:65439385-65439413
exon
HITS-CLIP
DIRECT
LncBasev2
11:65422921-65422949
exon
HITS-CLIP
DIRECT
LncBasev2
11:65425215-65425243
exon
HITS-CLIP
DIRECT
LncBasev2
11:65422921-65422949
exon
HITS-CLIP
DIRECT
LncBasev2
11:65425215-65425243
exon
HITS-CLIP
DIRECT
LncBasev2
NEAT1
hsa-miR-1915-5p
IP

Gene Details
Chromosome: 11
Transcript: NR_028272.1
Biotype: lincRNA
Gene id: NR_028272.1 (gene)
Gene Name: NEAT1
UCSC graphic: -
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD3 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-1915-5p
Sequence: accuugccuugcugcccgggcc
MirBase ID: MIMAT0007891
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
11:65422921-65422949
exon
HITS-CLIP
DIRECT
LncBasev2
11:65425317-65425345
exon
HITS-CLIP
DIRECT
LncBasev2
11:65422921-65422949
exon
HITS-CLIP
DIRECT
LncBasev2
11:65425317-65425345
exon
HITS-CLIP
DIRECT
LncBasev2
11:65425215-65425243
exon
HITS-CLIP
DIRECT
LncBasev2
11:65422921-65422949
exon
HITS-CLIP
DIRECT
LncBasev2
11:65425215-65425243
exon
HITS-CLIP
DIRECT
LncBasev2
11:65425317-65425345
exon
HITS-CLIP
DIRECT
LncBasev2
11:65425215-65425243
exon
HITS-CLIP
DIRECT
LncBasev2
11:65422921-65422949
exon
HITS-CLIP
DIRECT
LncBasev2
11:65425317-65425345
exon
HITS-CLIP
DIRECT
LncBasev2
PAXIP1-AS1
hsa-miR-1915-5p
IP

Gene Details
Chromosome: 7
Transcript: ENST00000608317
Biotype: lincRNA
Gene id: ENSG00000273344
Gene Name: PAXIP1-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
- Adipose Normal/Primary
- Adrenal Normal/Primary
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
- Brain Normal/Primary
- Breast Normal/Primary
HeLa Cervix Cancer/Malignant
- Colon Normal/Primary
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
Fibroblasts Foreskin Normal/Primary
- Heart Normal/Primary
- Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
- Liver Normal/Primary
- Lung Normal/Primary
Fibroblasts Lung Normal/Primary
A549 Lung Cancer/Malignant
- Lymph Node Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
- Ovary Normal/Primary
- Placenta Normal/Primary
- Prostate Normal/Primary
- Skeletal Muscle Normal/Primary
- Testes Normal/Primary
- Thyroid Normal/Primary
- White Blood Cell Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-1915-5p
Sequence: accuugccuugcugcccgggcc
MirBase ID: MIMAT0007891
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
7:155003705-155003733
exon
HITS-CLIP
DIRECT
LncBasev2
RNU12
hsa-miR-1915-5p
IP

Gene Details
Chromosome: 22
Transcript: ENST00000602478
Biotype: lincRNA
Gene id: ENSG00000270022
Gene Name: RNU12
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
HREpiC Kidney Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-1915-5p
Sequence: accuugccuugcugcccgggcc
MirBase ID: MIMAT0007891
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
22:42615321-42615349
exon
HITS-CLIP
DIRECT
LncBasev2
22:42615321-42615349
exon
HITS-CLIP
DIRECT
LncBasev2
22:42615321-42615349
exon
HITS-CLIP
DIRECT
LncBasev2
22:42615321-42615349
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-465B22.8
hsa-miR-1915-5p
IP

Gene Details
Chromosome: 1
Transcript: ENST00000606993
Biotype: lincRNA
Gene id: ENSG00000272141
Gene Name: RP11-465B22.8
UCSC graphic:
Expression:
  Cell Line Tissue Category
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-1915-5p
Sequence: accuugccuugcugcccgggcc
MirBase ID: MIMAT0007891
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
1:1169952-1169980
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-709D24.8
hsa-miR-1915-5p
IP

Gene Details
Chromosome: 16
Transcript: ENST00000612995
Biotype: sense_intronic
Gene id: ENSG00000278434
Gene Name: RP11-709D24.8
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-1915-5p
Sequence: accuugccuugcugcccgggcc
MirBase ID: MIMAT0007891
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: arsenite
Location
Region
Method
Result
Validation Type
Source
16:4533349-4533377
exon
HITS-CLIP
DIRECT
LncBasev2
RP11-810O3.2
hsa-miR-1915-5p
-
IP

Gene Details
Chromosome: X
Transcript: ENST00000603215
Biotype: processed_pseudogene
Gene id: ENSG00000270413
Gene Name: RP11-810O3.2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-1915-5p
Sequence: accuugccuugcugcccgggcc
MirBase ID: MIMAT0007891
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
X:114900387-114900415
exon
HITS-CLIP
DIRECT
LncBasev2
RP5-952N6.1
hsa-miR-1915-5p
-
IP

Gene Details
Chromosome: 1
Transcript: ENST00000419450
Biotype: lincRNA
Gene id: ENSG00000229051
Gene Name: RP5-952N6.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-1915-5p
Sequence: accuugccuugcugcccgggcc
MirBase ID: MIMAT0007891
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
1:70713291-70713319
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: