Please cite:
Maria D. Paraskevopoulou, Ioannis S. Vlachos, Dimitra Karagkouni, Georgios Georgakilas, Ilias Kanellos, Thanasis Vergoulis, Konstantinos Zagganas, Panayiotis Tsanakas, Evangelos Floros, Theodore Dalamagas, and Artemis G. Hatzigeorgiou "DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts" Nucl. Acids Res. (2016) gkv1270
Bulk download:
We have updated the bulk download module, which simplifies the download process! Please find the new online form by following this link

hsa-miR-200c-3p

Loading... Please wait, this might take a few seconds...



Filters
Gene
miRNA
Pr. score
Methods
AC098614.2
hsa-miR-200c-3p
-
IP

Gene Details
Chromosome: 3
Transcript: ENST00000368528
Biotype: processed_pseudogene
Gene id: ENSG00000213846
Gene Name: AC098614.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-200c-3p
Sequence: uaauacugccggguaaugaugga
MirBase ID: MIMAT0000617
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: EF3DAGO2
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
3:27633481-27633509
exon
PAR-CLIP
DIRECT
LncBasev2
AL845472.1
hsa-miR-200c-3p
-
IP

Gene Details
Chromosome: 9
Transcript: ENST00000624675
Biotype: pseudogene
Gene id: ENSG00000279561
Gene Name: AL845472.1
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-200c-3p
Sequence: uaauacugccggguaaugaugga
MirBase ID: MIMAT0000617
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
9:41271183-41271223
exon
HITS-CLIP
DIRECT
LncBasev2
AP003774.5
hsa-miR-200c-3p
-
IP

Gene Details
Chromosome: 11
Transcript: ENST00000569737
Biotype: lincRNA
Gene id: ENSG00000231492
Gene Name: AP003774.5
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-200c-3p
Sequence: uaauacugccggguaaugaugga
MirBase ID: MIMAT0000617
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment:emetine
Location
Region
Method
Result
Validation Type
Source
11:64421038-64421066
exon
HITS-CLIP
DIRECT
LncBasev2
ASB16-AS1
hsa-miR-200c-3p
-
IP

Gene Details
Chromosome: 17
Transcript: ENST00000585457
Biotype: antisense
Gene id: ENSG00000267080
Gene Name: ASB16-AS1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-200c-3p
Sequence: uaauacugccggguaaugaugga
MirBase ID: MIMAT0000617
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: no treatment (control)
Location
Region
Method
Result
Validation Type
Source
17:44177615-44177643
exon
HITS-CLIP
DIRECT
LncBasev2
ATP5A1P2
hsa-miR-200c-3p
-
IP

Gene Details
Chromosome: 2
Transcript: ENST00000412323
Biotype: transcribed_processed_pseudogene
Gene id: ENSG00000227682
Gene Name: ATP5A1P2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-200c-3p
Sequence: uaauacugccggguaaugaugga
MirBase ID: MIMAT0000617
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
MCF7
IP
Tested Cell Line: MCF7
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
2:155269645-155269673
exon
HITS-CLIP
DIRECT
LncBasev2
2:155269645-155269673
exon
HITS-CLIP
DIRECT
LncBasev2
Cervix
HELA
IP
Tested Cell Line: HELA
Category: Cancer/Malignant
Experimental Condition: Hela cells were treated with control shRNA.
Location
Region
Method
Result
Validation Type
Source
2:155269645-155269673
exon
HITS-CLIP
DIRECT
LncBasev2
BLOC1S5-TXNDC5
hsa-miR-200c-3p
IP

Gene Details
Chromosome: 6
Transcript: NR_037616.1
Biotype: sense
Gene id: NR_037616.1 (gene)
Gene Name: BLOC1S5-TXNDC5
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-200c-3p
Sequence: uaauacugccggguaaugaugga
MirBase ID: MIMAT0000617
Related Diseases:

Publication
Tissue
Cell Type
Methods
Cervix
HELA
IP
Tested Cell Line: HELA
Category: Cancer/Malignant
Experimental Condition: Hela cells were treated with control shRN.
Location
Region
Method
Result
Validation Type
Source
6:7882713-7882741
exon
HITS-CLIP
DIRECT
LncBasev2
BZW1P2
hsa-miR-200c-3p
-
IP

Gene Details
Chromosome: 3
Transcript: ENST00000473537
Biotype: processed_pseudogene
Gene id: ENSG00000198406
Gene Name: BZW1P2
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HREpiC Kidney Normal/Primary
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-200c-3p
Sequence: uaauacugccggguaaugaugga
MirBase ID: MIMAT0000617
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
3:116646111-116646139
exon
HITS-CLIP
DIRECT
LncBasev2
C14orf132
hsa-miR-200c-3p
-
IP

Gene Details
Chromosome: 14
Transcript: ENST00000555004
Biotype: lincRNA
Gene id: ENSG00000227051
Gene Name: C14orf132
UCSC graphic:
Expression:
  Cell Line Tissue Category
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant
LCLBACD2 - Normal/Primary

miRNA Details
Name: hsa-miR-200c-3p
Sequence: uaauacugccggguaaugaugga
MirBase ID: MIMAT0000617
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
MCF7
IP
Tested Cell Line: MCF7
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
14:96090912-96090940
exon
HITS-CLIP
DIRECT
LncBasev2
C6orf147
hsa-miR-200c-3p
IP

Gene Details
Chromosome: 6
Transcript: NR_027005.1
Biotype: sense
Gene id: NR_027005.1 (gene)
Gene Name: C6orf147
UCSC graphic: -
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HeLa Cervix Cancer/Malignant
HEK293 Kidney Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
MCF7 Mammary Gland Cancer/Malignant

miRNA Details
Name: hsa-miR-200c-3p
Sequence: uaauacugccggguaaugaugga
MirBase ID: MIMAT0000617
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: BC1
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
6:73274760-73274788
exon
PAR-CLIP
DIRECT
LncBasev2
6:73274760-73274788
exon
PAR-CLIP
DIRECT
LncBasev2
CASC7
hsa-miR-200c-3p
IP

Gene Details
Chromosome: 8
Transcript: ENST00000560295
Biotype: lincRNA
Gene id: ENSG00000259758
Gene Name: CASC7
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-200c-3p
Sequence: uaauacugccggguaaugaugga
MirBase ID: MIMAT0000617
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
MCF7
IP
Tested Cell Line: MCF7
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
8:140527315-140527343
exon
HITS-CLIP
DIRECT
LncBasev2
8:140527658-140527686
exon
HITS-CLIP
DIRECT
LncBasev2
8:140527315-140527343
exon
HITS-CLIP
DIRECT
LncBasev2
CTA-292E10.9
hsa-miR-200c-3p
IP

Gene Details
Chromosome: 22
Transcript: ENST00000623127
Biotype: antisense
Gene id: ENSG00000280111
Gene Name: CTA-292E10.9
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-200c-3p
Sequence: uaauacugccggguaaugaugga
MirBase ID: MIMAT0000617
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: LCLBACD1
Category: Normal/Primary
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
22:28788103-28788131
exon
PAR-CLIP
DIRECT
LncBasev2
Mammary Gland
MCF7
IP
Tested Cell Line: MCF7
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
22:28788103-28788131
exon
HITS-CLIP
DIRECT
LncBasev2
CTB-52I2.4
hsa-miR-200c-3p
-
IP

Gene Details
Chromosome: 19
Transcript: ENST00000621646
Biotype: processed_transcript
Gene id: ENSG00000273654
Gene Name: CTB-52I2.4
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-200c-3p
Sequence: uaauacugccggguaaugaugga
MirBase ID: MIMAT0000617
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:18031835-18031863
exon
HITS-CLIP
DIRECT
LncBasev2
CTB-89H12.4
hsa-miR-200c-3p
IP

Gene Details
Chromosome: 5
Transcript: ENST00000499521
Biotype: retained_intron
Gene id: ENSG00000230551
Gene Name: CTB-89H12.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-200c-3p
Sequence: uaauacugccggguaaugaugga
MirBase ID: MIMAT0000617
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: BC3
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:149496163-149496191
exon
PAR-CLIP
DIRECT
LncBasev2
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:149497499-149497527
exon
HITS-CLIP
DIRECT
LncBasev2
5:149502286-149502314
exon
HITS-CLIP
DIRECT
LncBasev2
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:149496163-149496191
exon
HITS-CLIP
DIRECT
LncBasev2
CTC-444N24.11
hsa-miR-200c-3p
IP

Gene Details
Chromosome: 19
Transcript: ENST00000593427
Biotype: lincRNA
Gene id: ENSG00000268205
Gene Name: CTC-444N24.11
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD2 - Normal/Primary
LCLBACD3 - Normal/Primary
LCLBAC - Normal/Primary

miRNA Details
Name: hsa-miR-200c-3p
Sequence: uaauacugccggguaaugaugga
MirBase ID: MIMAT0000617
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:57305998-57306026
exon
HITS-CLIP
DIRECT
LncBasev2
Cervix
HELA
IP
Tested Cell Line: HELA
Category: Cancer/Malignant
Experimental Condition: Hela cells were treated with control shRN.
Location
Region
Method
Result
Validation Type
Source
19:57306421-57306449
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2015B23.2
hsa-miR-200c-3p
-
IP

Gene Details
Chromosome: 5
Transcript: ENST00000514047
Biotype: processed_pseudogene
Gene id: ENSG00000226432
Gene Name: CTD-2015B23.2
UCSC graphic:
Expression: -

miRNA Details
Name: hsa-miR-200c-3p
Sequence: uaauacugccggguaaugaugga
MirBase ID: MIMAT0000617
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
5:24170994-24171022
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2303H24.2
hsa-miR-200c-3p
IP

Gene Details
Chromosome: 17
Transcript: ENST00000425211
Biotype: processed_transcript
Gene id: ENSG00000273018
Gene Name: CTD-2303H24.2
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
hMSC-BM Bone Marrow Stem/Progenitor
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HREpiC Kidney Normal/Primary
HepG2 Liver Cancer/Malignant
IMR90 Lung Embryonic/Fetal/Stem/Progenitor
A549 Lung Cancer/Malignant
HMEpC Mammary Gland Normal/Primary
MCF7 Mammary Gland Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-200c-3p
Sequence: uaauacugccggguaaugaugga
MirBase ID: MIMAT0000617
Related Diseases:

Publication
Tissue
Cell Type
Methods
Tested Cell Line: 293S
Category: Embryonic/Fetal
Experimental Condition: treatment: emetine
Location
Region
Method
Result
Validation Type
Source
17:18533334-18533362
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2527I21.9
hsa-miR-200c-3p
-
IP

Gene Details
Chromosome: 19
Transcript: ENST00000601692
Biotype: sense_intronic
Gene id: ENSG00000267874
Gene Name: CTD-2527I21.9
UCSC graphic:
Expression:
  Cell Line Tissue Category
HepG2 Liver Cancer/Malignant

miRNA Details
Name: hsa-miR-200c-3p
Sequence: uaauacugccggguaaugaugga
MirBase ID: MIMAT0000617
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:35036322-35036350
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2528L19.6
hsa-miR-200c-3p
IP

Gene Details
Chromosome: 19
Transcript: ENST00000588040
Biotype: lincRNA
Gene id: ENSG00000267152
Gene Name: CTD-2528L19.6
UCSC graphic:
Expression:
  Cell Line Tissue Category
K562 Blood Cancer/Malignant
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
LCLBAC - Normal/Primary
LCLBACD1 - Normal/Primary

miRNA Details
Name: hsa-miR-200c-3p
Sequence: uaauacugccggguaaugaugga
MirBase ID: MIMAT0000617
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
MCF7
IP
Tested Cell Line: MCF7
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:37729661-37729689
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2555O16.4
hsa-miR-200c-3p
-
IP

Gene Details
Chromosome: 14
Transcript: ENST00000609125
Biotype: antisense
Gene id: ENSG00000272909
Gene Name: CTD-2555O16.4
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
K562 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HeLa Cervix Cancer/Malignant
h1ESC Embryonic Stem Cells Embryonic/Fetal/Stem/Progenitor
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant
LCLBACD1 - Normal/Primary
LCLBACD3 - Normal/Primary

miRNA Details
Name: hsa-miR-200c-3p
Sequence: uaauacugccggguaaugaugga
MirBase ID: MIMAT0000617
Related Diseases:

Publication
Tissue
Cell Type
Methods
Pancreas
Beta cells
IP
Tested Cell Line: Beta cells
Category: -
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
14:64440664-64440692
exon
HITS-CLIP
DIRECT
LncBasev2
CTD-2630F21.1
hsa-miR-200c-3p
IP

Gene Details
Chromosome: 19
Transcript: ENST00000592087
Biotype: antisense
Gene id: ENSG00000267309
Gene Name: CTD-2630F21.1
UCSC graphic:
Expression:
  Cell Line Tissue Category
GM12878 Blood Cancer/Malignant
HUVEC Blood Vessel Normal/Primary
SK-N-SH Brain Cancer/Malignant
HepG2 Liver Cancer/Malignant
A549 Lung Cancer/Malignant

miRNA Details
Name: hsa-miR-200c-3p
Sequence: uaauacugccggguaaugaugga
MirBase ID: MIMAT0000617
Related Diseases:

Publication
Tissue
Cell Type
Methods
Mammary Gland
BT474
IP
Tested Cell Line: BT474
Category: Cancer/Malignant
Experimental Condition: -
Location
Region
Method
Result
Validation Type
Source
19:36490368-36490396
exon
HITS-CLIP
DIRECT
LncBasev2
Funded by: